DC900354

Overview
NameDC900354
Unique NameDC900354
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length674
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900354_ssr1 microsatellite DC900354_ssr1:1..18.
DC900354_ssr605 microsatellite DC900354_ssr605:605..616.
Csv1_Contig5660 contig Csv1_Contig5660:1..674. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900354 VSS Citrus sinensis cDNA clone VS28915 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900354 ID=DC900354|Name=DC900354|organism=Citrus sinensis|type=EST|length=674bp
GAGAGAGAGAGAGAGAGAGCTAGTCTCGAGTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTGNGAAGAAACAAGAATAAACGTATATACAATTAAT
ATTCTCGTCAAAACAGAAAGTTAAAGAGAGTATTTAATCAAAAGCCCCTN
ANNTNATGAAACATATTGAAAATCTAAGAGCGCATATGGGCCCATCCCCC
AGATCTTCAACTTTCAACCACCAAATCATTCACCAATGGAAATTATTATG
GAATTGACACAAAATATGAACCCACCACTTGAAACCAAATCCGGCAATCA
TGCCACTAACATCTTAACAATAAACAAAGATAAAAAGAAAAGATTGCTGA
ACTCGGTCAAATTAAATAATTAGAGCGTAGACATTCAACTTTACTCGTTT
CGAAGTAAAAGGAAAAGAAAATATCTACAAGCCTTGCCTTTCTNTNTNTN
TACCAAACCGAAATTAATGGCACCAAAGGCGGAGAAGAAGCCGGCTGAGA
AGAAGCCAGCGGAGGAGAAGAAGACATCGGTGGCCGAGAAGGCGCCGGCG
GAGAAGAAGCCGAAGGCCGGCAAGAAGCTTCCCAAAGAAGCCGCCTCTGG
CGACAAGAAGAAGAAGCGCGCGAAGAANAGCATCGAGACGTACAAGATTT
ACATCTTCAAGGTCCTGAAGCAGG
back to top