DC900353

Overview
NameDC900353
Unique NameDC900353
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length912
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900353_ssr888 microsatellite DC900353_ssr888:888..897.
Csv1_Contig6999 contig Csv1_Contig6999:46..957. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900353 VSS Citrus sinensis cDNA clone VS28914 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900353 ID=DC900353|Name=DC900353|organism=Citrus sinensis|type=EST|length=912bp
CCACCGCGTAAGTAAGAAGCTCAATCTCAAAGCAATGGATCGGAAGACTG
TACTTGCATTTGCATTGATGTGCGTCATTGTCGCCGGTGTCGGCGGCCAA
TCCCCGGCTGCTGCACCAACAACAGCTCCTGCAAAGGGTAGCAGCCCAGC
AAAAGCTCCATCCACAGCTCCTGCAAAGGGTGGCAGCCCAGCAAAAGCCC
CATCCACAGCTCCAGTGAAAGCCCCCGCTAAGCCCAAATCACCAGCTCCC
GCCGCTGTTCCAGCAGCTGCTCCCCCATCTACAACCCCTGCAAAGGGTGG
CAGCCCAGCAAAAGCCCCATCTACAGCTCCAGTGAAAGCTCCCGCTAAGC
CCAAATCACCAGCTCCCGCCGCTGTTCCAGCAGCTGCTCCGTCTAAACAG
GCTGTCCCCGCTCCGGCAGCAGCTCCCACATCGACTCCTCCGGCGGCTAC
TCCAGTGAGTTCGCCTCCAGCTCCGGTTCCAGAAGCGAAATCACCTCCAG
CACCTACTCCTAAAGCTGCGCCGGAGACTTCACCAGCGGCTCCATTGGCT
TCGCCCCCGAAAGCCGAGGTGCCTGCGCCGGCTCACAGCAAGAAGAAGTC
AAAGAAGCACCATGCCCCAGCTCCTTCCCCGGCTTTGTTGGGCCCGCCAG
CACCACCGTCGGAGGCTCCGGGACCGAGCGCCGACTCAATGTCTCCCGGT
CCATCTGTCGCCGACGACGAGAGCGGCGCAGAAACGATCCANAGTGTGCA
GAAGATGATGGGCGGGTTGGCATTGGGATGGGGTCTGCTAGCTTTGATCA
TCTANANANAGATGTTACCGTCGTTATTATTTTGATCTTCTTTGTTCATT
TTTTACCCCTCATGTTCACTCTGTTATTACACATTTGATATATATATTTT
TTTAATTTGCTT
back to top