DC900344

Overview
NameDC900344
Unique NameDC900344
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length341
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900344_ssr254 microsatellite DC900344_ssr254:254..263.
Properties
Property NameValue
Genbank descriptionDC900344 VSS Citrus sinensis cDNA clone VS28901 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900344 ID=DC900344|Name=DC900344|organism=Citrus sinensis|type=EST|length=341bp
TGACGATGTTCCTGCTGGTGGTAGCGGTGCTGGCCCCAAGATTGAGGAGG
TAGACTAAGCAGCTCTCGTTTTCTGCTGGCTTTTGTCTGTTGAGGGTTAA
GTTGGTAGGGTGATTAGATGTTTCGGAATTTTAATTTTATTTTCATGCTT
TTGACTATTATTGGGTTTTGATTGATCTTTTACAAGTCTGTTCAAAAGCC
CATTGCAAGTGTTCTCTATGTTTTCTCAATATACTTTTTTTCATCTATTG
CGGATATATATATTGTTGGACGCAGGGACTAGAACAGCCCTGCTTGCTTA
TTCATTACTTTGAAACTTTTCTTGCTAATTTATATTTAACT
back to top