DC900314

Overview
NameDC900314
Unique NameDC900314
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length569
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900314_ssr350 microsatellite DC900314_ssr350:350..361.
Csv1_Contig9895 contig Csv1_Contig9895:62..631. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900314 VSS Citrus sinensis cDNA clone VS28664 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900314 ID=DC900314|Name=DC900314|organism=Citrus sinensis|type=EST|length=569bp
CTCAAACAAACCAACAGGAAAATAATAAATATAATAATAAGAAGAAGAAT
CAAATTTCTTTAGCAGAGGATCATCAGGAGCAATGAGTTACTACAATCAG
AATCAGCCCCCTGTTGGTGTACCCCCTCAGCAAGGTTATCCTCCAGAGGG
ATATCCNAAGGACGCTTATCCTCCACCGGGATATCCTCCTCAGCAGGGAT
ACCCCCCGGGTGGTGGCTATCCTCCACAACAAGGATACCCTGCGCAGGGT
GGCTACCCGCCTACTCAGTACGCTCCTCAATACGGCCAGCCTCCCCCCCC
GCAACAAAAACAAAGCGTTGGTTGCCTCGAAGGATGTTTGGCTGCCCTGT
GCTGCTGCTGCTTGCTGGATGCTTGCTTCTGATAAACAATGAGTAGCAGC
TTGATTGAAGTTTGGTACTAAGGCGAATTAAATATAATTCAATTCTTTAG
TGTCAAATCACCTGTTTGTGACTTGTTTTTAGTTTCTCATGTGTATTTTT
TTTTTTTCTATCTTTCAAATACCCTTACTGCCGTTTATTTTCGTTAATAA
GATTTGAGACTTTTGTTTG
back to top