DC900312

Overview
NameDC900312
Unique NameDC900312
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length786
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900312_ssr259 microsatellite DC900312_ssr259:259..270. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900312 VSS Citrus sinensis cDNA clone VS28662 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900312 ID=DC900312|Name=DC900312|organism=Citrus sinensis|type=EST|length=786bp
GATTTGATTTTAACACCCAGTCGGGACTTTCATGATCCGGGTATACAAAT
TCTATCTAGACAACCGGCCCTACAACTCAGGTAGCTACAGCATGGCAGGA
TCACATAATTCATTTGCAAAAAATAATAAGGCACAACAATATCAAAATTA
TAACATGTCGCTATGTAGCTAGGACACCAGAAAACAGGAGCTTCACAAAG
CAAACGAGCATATTAACACCCTCACACCAATCTCTCCTTTCTCTCTCAAC
TTTTTTCTTCATCATCATCATCTTAACTATCATTTGAGGAGCTTCCCCTG
ACAAGAGAACCTCGACGGTGGCCACCTACAATTGCATCTTTAAGACGAGA
TATGGGACCCAACAACCTGCTCCCTTTCTCATCATTGATGCTGAGCTGCC
ACTTCAGCTGCAAAGCTTGCCACCTTTCTTGTTGCCACTGCTGCCCAATA
ATTACAATGCCCATCACAGCCGCTGCAATGAAAATGGACCAAAATGTATT
TGTCTCCTTTGCATGAGCATACAAGGAAGCTGCCCTTCTCTTCCACCATG
CTTCACAGGGAAGGTCAGACTCAGCAAATTTGTCATCTTCTTTTGCAGGC
ATCAGAGATTTTGATGCGTCTGCAGGAACATTTAAACCTTGCTCAGAAAG
GNTCAGNTAGCTCAGGAGTCTCCAAGTTCTCATTGAGTGCCGCGTCACCG
NGGAAGAACTAACGTAGCCGCACTGGAATACTCNTTCTTCTGNCAATAAC
CGGGAAGGGGNCTTTTAACTTGACTCTAGGAAGCGG
back to top