DC900305

Overview
NameDC900305
Unique NameDC900305
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length550
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1120 contig Csv1_Contig1120:135..684. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionDC900305 VSS Citrus sinensis cDNA clone VS28654 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900305 ID=DC900305|Name=DC900305|organism=Citrus sinensis|type=EST|length=550bp
AATCTTCTCATCGTTATATCACCAAAGGAAAACAAAAAATGTCTGGCTGT
GGTGGAAACTGTGGCTGTGGTTCTAGCTGCAAGTGCGGCGGCGGCTGCGG
CGGTAGCGCCATGTACCCTGACTTGAGATCCTTTGAGAGCACCACCGTCG
CCACCGAGACCCTCGTCCTCGGTGTTGCTCCTGTCAAGATGCACTCTGAG
GGGTCCGAGATGGGATTCGGAGCCGAGGGCGGCTGCAAGTGTGGACCAAA
CTGCAAGTGCAACCCTTGTAACTGTTAATGAAGATTACGAGACGTGAACA
TGCCCCATAATAAAGCAGCGCTGTGAGGTCGTTTAAATTGTAGTATCAAT
AAAAAGAACTATTTGTCTTTTGTGGTTGGCTTTGTTGGATGTCTTTTTAT
GAGCTTTTGTTTGTAAAATAAAAACCAGCCATGGCTGCTTCTCCGAATCC
TTAACTGGGTTTGTTGCAGATCCATGGCTAGTTAATTAATCATTAAGTGT
ATCTGTTACTGCTGCTTTTCTAATGGGAAGCTTCCTCTCAGACTTTTATC
back to top