DC900299

Overview
NameDC900299
Unique NameDC900299
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length298
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900299 VSS Citrus sinensis cDNA clone VS28646 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900299 ID=DC900299|Name=DC900299|organism=Citrus sinensis|type=EST|length=298bp
CTCAAATCTCTCGGTGGCTAACTCTTGGAGACAAGTTATAGAGGCTCACC
AATACGTGATCATCAAGTCATTTAAAAAGCAAAGCAATGTCCATGGTCTT
TTGGGTTTGAAGTATGATTGAATCCTCCTTATTCGTGGGTGCAGCTTTCT
CATTTCACCTTTACAGATGTATTCTTTTGTTGGAGTAAAATTATTGATAT
ACATGTAAAATTTTTGTTGAAGAGATGACATACTAGGAACTTGTTTTCTG
CTTTATTACCCATTTTTTTCTATCCTAACGGCTTTAATTTTGTTGTCC
back to top