DC900298

Overview
NameDC900298
Unique NameDC900298
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length465
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9101 contig Csv1_Contig9101:214..679. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900298 VSS Citrus sinensis cDNA clone VS28645 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900298 ID=DC900298|Name=DC900298|organism=Citrus sinensis|type=EST|length=465bp
CACAGGGACAATATGTCCCTACGCTTGCTGGAGGACAGCCGAGACCAACA
GGAATTCCACAGCCTATAGCTCATGCAGGTGCCATGGACTTTCACAGTTA
TGACAATGAGGCAATGATGAAACTTCGAGCAGAGAGAGGTGGAAGGGCAG
CANGATGGAGCATGGAGCTGAGCAAGAAAAGAGTACTCGAGGAAGCCTTT
GCAAGCATTTGGATTTAATTTCTCCAAGCACCAATCGTTCTCCCCAATTC
GTTGAAGGGCCTCATTAGGATTTGACACCAGTTTCCTCATTTGTCTATTT
GAAGAGGGAACTATAGATTTTCTGTCAAATTCTGCTATGAGAGTTAAGCT
TGTTAGATTTGACATTTTGACTCTGAAGATTTCACATGTCGAGACGTGTA
ACATTATTGCCACATTTTAGTGGAAAAAGTTGCATCTCAGTCCAATCTTA
TTTTGAACTTTCTTT
back to top