DC900297

Overview
NameDC900297
Unique NameDC900297
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length161
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1651 contig Csv1_Contig1651:640..800. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900297 VSS Citrus sinensis cDNA clone VS28644 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900297 ID=DC900297|Name=DC900297|organism=Citrus sinensis|type=EST|length=161bp
TTAGACCAGCTTAGATGTTGGAGTTTAGGGTATAGGAGATTTTTTGCTTA
GGTATTGTGGGGGTGAAATTATTTCATTCTTTTTTCTTCTTTTTTCCTTC
TCTTTGAATGTGGAATTTTGCTGAGATTTTTACAGCAATATAATCTATTG
TCTGTTTTTGC
back to top