DC900294

Overview
NameDC900294
Unique NameDC900294
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length342
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6088 contig Csv1_Contig6088:1304..1646. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900294 VSS Citrus sinensis cDNA clone VS28641 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900294 ID=DC900294|Name=DC900294|organism=Citrus sinensis|type=EST|length=342bp
AAGAAGCCCGACACCGACTTCGAATTTTACAAGTGAAGAGGGCTAGAAGA
GTTTATGAAGATCACTTTGATAATGTTTGTCAGATTGTCTCGCTCACTAT
GAACATCGTTGCCATTGGTCATGCATCGCCACAACTTGTGATATGGCTTT
ATTAGACTTCATTGAGCATTATATTCCAGCTTAAGTTAGAGTAGCGTTAA
AAATCAGAAAAATCTGAATTAATGGTTTGATTTATGTCTGATTTTGCGCC
ATATTATGACTTTGAATTAATATTTTTACGAGGCCTAGTGTGCACAAGTA
CGTTTGTATTTTTTAAATTTTATTATTATTTTTGGGCTTCAT
back to top