DC900290

Overview
NameDC900290
Unique NameDC900290
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length555
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900290 VSS Citrus sinensis cDNA clone VS28636 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900290 ID=DC900290|Name=DC900290|organism=Citrus sinensis|type=EST|length=555bp
CAGAGTCAAATTATTCTAGATGGAACAACCATTTGGGAACACAAAGAGTT
CATTATGGGAGGAGCAATGTGGAGTCTAACCGTGCTTCGAGACACAATGA
CAATTCACAGCAGCAAAGAATTCGTGATCATCGAGGTTTACGTTGGCGCG
GTCCGCAATGGTCTGGATCCAACAACCGACGGTGATTGCAGCATCTCAGC
TTACTTTGCTTACAAATGAATCTCAGTACTAAGGTTGATGGTTAGTAGGG
ATGGTGCAAAATTTCCATTTCACTGATGGCTATTGCTTCGAAGATGGGAC
CAACAGAAAGAAAGCAAGAAATGCAAGATTTAGATATGCATGTTGTTCCT
TTGTCAACACATCAATGTACGATAAGATTAGAAACGAGCATAGTGTCTTT
GACACAGACAATAATAGGGATGGATTGTCACTTTGTCAGTTGATTTTAAA
GAGTTTGAATCTCTCGTAGTTCCATGCATCTGAATACATTCACTTGTCAA
TTTTGCTTAAACTAAGAGCATCTCCAAAAGACTTTTTAAATAAAATTATA
CTTCT
back to top