DC900287

Overview
NameDC900287
Unique NameDC900287
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length595
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900287_ssr570 microsatellite DC900287_ssr570:570..579.
Csv1_Contig3371 contig Csv1_Contig3371:37..631. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900287 VSS Citrus sinensis cDNA clone VS28633 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900287 ID=DC900287|Name=DC900287|organism=Citrus sinensis|type=EST|length=595bp
TAAGCCCAAATCGCCAGCTCCCGCCGCTGTTCCAGCAGCTGCTCCGTCTA
AACAGGCTGTCCCCGCTCCGGCGGCAGCTCCCACATCGACTCCTCCGGCA
GCAGCTCCCACATCGACTCCTCCGGCGGCTACTCCAGTGAGTTCGCCTCC
AGCTCCGGTTCCAGAAGCAAAATCACCTCCAGCACCTACTCCTAAAGCTG
CGCCGGAGACTTCACCAGCGGCTCCATTGGCTTCGCCCCCTAAAGCCGAG
GTGCCTGCGCCGGCTCACAGCAAGAAGAAGTCAAAGAAGCACAATGCCCC
AGCTCCTTCCCCGGCTTTGTTGGGCCCGCCAGCACCACCGTCGGAGGCTC
CGGGACCGAGCGCCGACTCAATGTCTCCCGGTCCATCTGTCGCCGACGAC
GAGAGCGGCGCAGAAACGATCCAGAGTGTGCAGAAGATGATGGGCGGGTT
GGCATTGGGATGGGGTCTGCTAGCTTTGATCATCTAGAGAGAGATGTTAC
CGTCGTTATTATTTTGATCTTCTTTGTTCATTTTTTACCCCTCATGTTCA
CTCTGTTATTACACATTTGATATATATATTTTTTTAATTTGCTTC
back to top