DC900281

Overview
NameDC900281
Unique NameDC900281
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length313
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Properties
Property NameValue
Genbank descriptionDC900281 VSS Citrus sinensis cDNA clone VS28628 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900281 ID=DC900281|Name=DC900281|organism=Citrus sinensis|type=EST|length=313bp
GTTTTAAGGCTTATCCATCGATGACATTTCATCTCCAAGAAGCGGATTAT
ATAGTACAGCCTGAAAATATGTACTTCATTGAACCAGATCGAGGTCGTTT
CTGTGTGGCAATTCAAGACGACCCGAAATATAGTATACTGGGAGCATGGC
AGCAGCAGAATATGCTAATCATTTATGATCTGAACGTGCCTGCGCTTCGA
TTTGGATCTGAAAATTGTGCAAATGGGCGCCAGTGAAATTCACTAATCCT
CTTTAATCAGCTGTTATATTTGGTGTAATAAATTGAATAATGATGAATAA
ACTCTGCTTCATA
back to top