DC900276

Overview
NameDC900276
Unique NameDC900276
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length495
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900276_ssr1 microsatellite DC900276_ssr1:1..36.
Csv1_Contig2067 contig Csv1_Contig2067:471..965. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900276 VSS Citrus sinensis cDNA clone VS28621 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900276 ID=DC900276|Name=DC900276|organism=Citrus sinensis|type=EST|length=495bp
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCTCGTGCCGAATTC
GGCACGAGAAGCACCTGAAGAAGCAGCTTCCACAGGAGTTCCAGTCGGCA
AGACTGACTGAGGAATAGAGCCCTATCAAAAGTCGGCCAAGTTTTATTTA
CTTTTTACATAATTTTTTGTTCTAAGTCAGTCTTGTTATTATTAAGTTTT
TAATTAAGGGTTGTGATCTGAGGTTTGAATATGGAGCATAGGATTATGCC
AAGCGATTCGATCCACACACAATACATCAGCGCACCCTGTACGTACGCGG
CTTGCTACTATCCAATTCATGCTGAAGAGGTGCATGATTGATGGATTATT
GAGGAATGCTTTCCGCTTACGTCACGTCGGGGTTGCAGTTGTGGGTTCCA
AAGAGGGTCGTTTCGCTGCTTAAGAGTTTGATGGATGGTGTGATGAGAGT
CTAGTCATTACATGTGTGAATTTAATTATCTCTAGGATTTGAGTA
back to top