DC900275

Overview
NameDC900275
Unique NameDC900275
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length366
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4148 contig Csv1_Contig4148:37..402. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900275 VSS Citrus sinensis cDNA clone VS28620 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900275 ID=DC900275|Name=DC900275|organism=Citrus sinensis|type=EST|length=366bp
TTCTTCTTCAAGTTTGCTCTCGTAGCTGCACTTTTGGCTTTTGCTGGTCA
GCAGTTTGGAGCAGAAGCAAGGTATGGGGTAGGCATTCACTGCACCAAAG
ATTCTGATTGCAGTCAACCTCATTGTAAATGTGATCTGGCTTTAAGCATG
TGTAATTGCTTTATACCACCGGTAGGGTCAATTGCTGAAGCTGTGAACAT
GGGGCAAAAGCTAATGGAGAATGATAATCACCATGCATGATTATTTTTGT
AATATATAGAAGTGGAAGAGCGTACATATATTTGCAGAGATGCTTATATA
TGTTTAACTTATCAAGCTTTGAACTCCTATGATGAATAATTAAGAAGTAA
AAAGATAATTTTCAAG
back to top