DC900272

Overview
NameDC900272
Unique NameDC900272
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1225
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5729 contig Csv1_Contig5729:177..1402. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900272 VSS Citrus sinensis cDNA clone VS28617 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900272 ID=DC900272|Name=DC900272|organism=Citrus sinensis|type=EST|length=1225bp
GAAGACAGAAATAGTGAAGTGCTGGAAGAATCCAAGAATTCTGTTATCCC
TATTCCAGATGTACTGAAATCTTCTGCAGAAAATTATTCTGATAAACGTA
TCGTCAATCGATGTGGTTCTTCACAGGAAAGTGATTCTGATGAGGATATT
GATGATATATGTGATTCTAAGGATTTGAGGCCGGCAGGGGATGTTAAGGA
TGATGCAACGGAGGAGAACACAAATGATGTGTCTAGAAAGCTGTTCTTAC
TTGGAGATTTGCTTTCAATACATAATGTGGGCACAAAAAACTCCCTCTCC
AAATCTGCCATTGGTAATGAGATTGACGCTGAAAAAGAGTCTTTCCAGGG
ATCTAGTGCAAAAGCGGCATTGGCAAACCCCGAAGAAGCAAATGGTGGCA
CTGCAGAAGAAATCTTGACAGGTGCTGATTTTGTTTCTGCTTCTGAAGAA
TCACAGAATGGCTGTGGGGAAGCAATCCCAGGAAACCCTACTCTTGTTTC
TGCTTCTGAAAAAGCCCATGATATAAGTGAAGAGGCATCCTTGGCAAGCC
CTGATGGGGTTTCTGCACTCAGTGAATCAACAAAAATCAGCACTGCTGAA
AAGTCATCCTATAATAGCATGGTGGAAACAGGAAGTATCACGTTTGATTT
TGATGCTTCTGCTCCTGGGGCAAGGGGCAAAGAGGAGCCTCTAGGTGATT
CTCAACGTATTGAGACTCCAGGAATGTCCAGACTTGAAGATGCTCCACGT
CAATCAGTTTCAAGCCAGTTTCACAGTGGTCTTGGGGAGTCAAGTTTCTC
TGCGGCAGGTTCATTACCCAGTCTGATAAGTTATTCTGGGCCCGTAGCAT
ATTCTGGCAGTATCTCCCTAAGATCAGACAGCAGCACAACGAGCACCCGC
TCTTTTGCTTTTCCTATATTGCAGACTGAGTGGGACCGTAGTCCAGTAAG
AATGGCAAAAGCTGACCGGAGGCACTATCGGAAGCATAAGTGGAAGCAGG
GCCTTCTTTGCTGTAGATTCTGATTGTTCTATCTTTCTATCAATAGGTTC
AAGTTCGAAAATATATATACATCATCAAAATCTGATATTGTAGTTCTTTT
TGTTTATCTAGCCCCTTATAGTATGGTTTATTGAGCAATATAGATAGGTA
TACACCGTGATCCTCTTGATCTGGCTTGGATTGNNCCGTGCGGTAGGTTT
AATGCATTATGCATTGATTTAGTCC
back to top