DC900266

Overview
NameDC900266
Unique NameDC900266
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length710
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900266 VSS Citrus sinensis cDNA clone VS28609 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900266 ID=DC900266|Name=DC900266|organism=Citrus sinensis|type=EST|length=710bp
GTCAATCAGCCAACAATCCTANTCGATACTAAATATTGACCNCTGACTAA
TTACTGGACGGNAATGCCACATAGTCTACAATATATACCAGTCTCTCAGC
TGGGCTTCATCAGTGTCAGCTTTCTTCTCAGCTTCAGCTGGCTTCTCAAC
TGCAGGTTTCTCTTCATCTTTCACTTCCTCCTTTGCAGCTTCAACTTCTG
CCTCTGGCTTCTTCTCTTCTTCCTTGGCCTCTTTCTCAGCAGCTGGCTCT
GGTGTCTCCGTTGGAGTAGTTTCCACTTCTTCAGTTTTCTCTGCGGTAGT
CTTCTCCGCTGCTGCTGGCTGATCTTCGGCTACCACCTCCTTTGTCTCAA
CTTCAGCTGGGGCTTCAGCTTCTGGAGTAACCACCGCTGCTTCTTCAGTT
ACAGCAACAGCTTCTGCTTCCTTTGCTGCTGGTGGCTCTTCAGCAACGGG
TTCTGGTGCCACAGGTGCTGCAGAAGCTGAAGCAACTACCTCCTCTGTTT
TAGTTTCTTCAGTCTTGACTGGTTCATCAGCTGTTTTAGTTTCTTCAGCC
TTGACTGGCTCCTCAGCTGTTTTAGTTTCTTCAGCCTTGACTGGCTCCTC
AGCTTTGATCTCCTCGGAAAGAGCAGTCTTTGCTGACACAACCTCAACTG
TGGCCATATTGCAATTTCAACAGCTAGAAAACTACAAAGAAAACAAGTAT
ATAAATATAA
back to top