DC900265

Overview
NameDC900265
Unique NameDC900265
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length490
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11045 contig Csv1_Contig11045:624..1109. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900265 VSS Citrus sinensis cDNA clone VS28609 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900265 ID=DC900265|Name=DC900265|organism=Citrus sinensis|type=EST|length=490bp
GAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTAAGCAAAACAACT
GATATATATTATTATTACTGATTCACCAAGCCAAGTAGCCAACAACATAC
TTGAGCTTCTATTTATAACATACAAGCAAACAGTACATAATACACAAATT
TCAAGAACCCACCACTTGGCACCAACAACCCAATTCCTCATAGCACGTAC
CGAAATTTCACCATTAAGCTCAGACCATGCTTTTTCTTTGAATCAATTCA
CTGATCATGGATGTCATGATGATCAGCTATGTGGAGTTGCAATTAATGGT
AGATCCAAAAGTGGGGTCGTTTGCAGATACCAAGACTCAAACAAAATCCC
TTATTGTTACCGAATACTAAAATATTTGAAACCACTGAACTAAATTAACT
TTGGGACGTGCAAATTGGCCATCATTAGTTCTTACAATATTATTACTCAG
TCTTCTCAGCTGGGGCTTCATCGGTAGTTTTAGTGGTAGG
back to top