DC900262

Overview
NameDC900262
Unique NameDC900262
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1294
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900262_ssr982 microsatellite DC900262_ssr982:982..993. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900262 VSS Citrus sinensis cDNA clone VS28606 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900262 ID=DC900262|Name=DC900262|organism=Citrus sinensis|type=EST|length=1294bp
CTCATTTCATCTTTCCTGAATCTCAATGGAGACCCCATCATCGTCAACAA
GAAGAATCACCAGGTCACAGACTTCGGCTGCTGTCAACAATATTCCCATT
TCAAGGAGAATTGAAGATGCTGAAAAGGGTGTTTCAAAATCAAGACAGAG
AGCCACAAAACAACAACAAGATCGGTCTGCGCTGATTGATATAACAAATG
ATTCACCGATTGTTGGGCTTGCAACGGGGGTCTTGGAGGAGACTCCATCA
TCGGCCGTGGCCAAGCGAAGGACCATTAGAGCCAAGAACAGCACACCTGG
CTCTGGAGAGGCTTTGCTTAGGTGTCAAGCGAAGACTCTCCTGCAAAAAG
TTGAGGAAGAGGCTGAGCTTTCAAAAATCTCTCTGGAGAGTCGCCCATTT
CTTCATCTTCAAGGCTTTGTAAACTCTCCAATGCGACTTCTTGCTCCAAC
TCCAGCAAATACGCCGCAAGTCTTGAATCTTTCTGAGGATGCCAACAACG
ATAATGATTTGGCCTCAATCAATGCTTCGCCAGTTACTCAAGAACAATTG
ATTTCTCTGGTGGTCGGTGAGATCAAGATCGAAGAGGGAATTGAATCGGA
TATAAATACGATATCTCGTTCTTTGCTGCTGGATTTCTCTGAGAAANCAG
AATCAACAGAGTGCTCCTCTGTGGAGACTGACGCGGGAAAGAGTGCCGGC
AAAGAGAAATCATATCCAGATGAGGATGACTCTTCTGTTTGGTCCATTCA
GGTCAACGCAAGCATTCATGATGAAGAAGAGGAAGTAGATGAATCTTACA
ACGACAATTACGAAGAAAATGAAGCTGAAGAGTATGATGAAGTATTGCTT
GATGAACTCTGCGAAGAACTGAGCAAGATTAGTGTGAATAATACGGAGCA
GACAATGGCTAAATTTACAGGACGGCACNCAAGATACTTGNACAACAGCG
ATGATGAAATAGTTGAAGAAGAACTAACTGTTAATAATAATAATTTATCA
ATTGGTTTCTCGCCCAACGTCTTATCCNTGAAGGGCTTGCCAACNCCGAA
AGGGAAACACATTCGCTTCGCAATTGAGGAAGAAGAAATTGTCGACTGAG
GCTCTCTCATTGTCATTGGTTTTCTTTTGACTTGACTTCTGATGTCCCAT
CATTGAGTTTATGCTGTTTTGTCATTTTTTGGCTGGGCAATTGTTTTGAT
GAGAAAAAGAAAAAAAATACTTGTAATCNCAACGACGTGATGACGTTTTG
AATTAATGAAATTTGATGAATCTCCCTTTGCAATTGAGGAAGAA
back to top