DC900261

Overview
NameDC900261
Unique NameDC900261
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length501
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900261 VSS Citrus sinensis cDNA clone VS28605 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900261 ID=DC900261|Name=DC900261|organism=Citrus sinensis|type=EST|length=501bp
CAGTGATATCCCAACGNATCAGTCGCATGTGTATTGCGGATCTAAACATT
AGGTTTGGAAGCATATAGCTTCTTTCGTTGAGAAATCACTTAGATCATAG
GTAATAGCTTGTAGTAATATCATCTCTTTGTGGCTTCTTTGGAGCATCCT
TGGGCCCTTTGCAGTCGTCGGTACAATTGTCGTCGCCATTTGCAGGACAG
CAGGGTATGAATTTTCGTTTTTCCCTCACCTACGTAGAGAACAATAGTGT
AGTAAATTCTATGGCTAATCTGGGTGTTGTTTGCCATGAGTTAGCGGATG
GAGTTCGCTGCCAGTGGAGACTCGGAGAGCTATTTCTAAAGACGCTAATG
ATTTCCCCAACTATAGATTTCATTGATTTTGTTCTTTATTGTTTCTGGCT
TTCATCTGTCTTTTTCAGTTGCTTGTTTTACAGAACCTTGGCTCTTGTTT
ATTTCAGCACTATGCATTTTTTTAAGGGTAATGGTAAAGCTCATTATATA
C
back to top