DC900258

Overview
NameDC900258
Unique NameDC900258
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length597
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5648 contig Csv1_Contig5648:1..597. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900258 VSS Citrus sinensis cDNA clone VS28604 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900258 ID=DC900258|Name=DC900258|organism=Citrus sinensis|type=EST|length=597bp
CTCGTGCCGAATTCGGCACGAGCGGCCTTGAATGATGATGTATGGAGATT
GGAGAAGATTGGCAAGGATGGATCATTCCACAAGAGGCTAAACAATGCTG
GGATATTCTCAGTTGAAGACTTTCTTCGTCTTGTCGTGAGGGATCCTCAA
AAACTACGTAGTATTCTTGGAAGTGGAATGTCAAATAAGATGTGGGAAGC
TCTTTTAGACCATGCAAAGACTTGTGTCCTAAGTGGGAAGCTTTATGTTT
ATTATCCTGAAGATTCAAGAAATGTTGGTGTTGTTTTTAACAACATCTAT
GAGTTGAATGGTCTAATTTCAGGGGAGCAGTATTTTCCTGCTGATGCTCT
TCCAGAGAGCCAGAAGGTTTATGTGGATTCACAGGTGAAGAAAGCATATG
ACAATTGGAATCAAGTTGTAGAATATGATGGCAAGTCACTTTTGAGCTTA
AAGCAAAATAAGAGGTCAAATGCATCTAAAAATGAACTTCAAATAGGTCA
GATAGATTTCTCTAATGCTTTAGACAATCAGTTGCAACTATCCCGCTTGC
CAGCTGCTGTTCCTACTGAGCAATCTTCAGCTCATTCAGGTCATCTG
back to top