DC900253

Overview
NameDC900253
Unique NameDC900253
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length774
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900253_ssr168 microsatellite DC900253_ssr168:168..179. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2120 contig Csv1_Contig2120:90..863. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900253 VSS Citrus sinensis cDNA clone VS28293 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900253 ID=DC900253|Name=DC900253|organism=Citrus sinensis|type=EST|length=774bp
CTCAAAATGGCTGAAAGGATCCACCCCGAAACGACACCGCGCAGCGAACA
AGAGCCCTCACATCCGCCGGCGCCCGCGGCCGCAGGAACCTACGTCATCC
AAGTCCCGAAGGATCAAATCTACCGAGTTCCGCCCCCCGAGAACGCCGAC
CGCATCAAGGGCCTCTCCCGCCGCCGCCGCAAATCCCGCAGCACTACTAC
CTGCTGCTGCTTCCGTTTCTGCTGCTGCTCGCTGCTTCTCCTCGTCCTCC
TCTTGGCCATCGCCGCCGGCGTCTTCTACCTCGTCTTCCGTCCCGAATCC
CCCAACTACTCCGTCGACGGCGTCTCCATCGCCGGCCTCAACCTCACCTC
GCCGTCCTCCGTCGTCTCTCCCCGGTTCGACGTCTCCGTCACCGCCGACA
ATCCGAACGACAAGATCGGAATCTACTACGAGAGAGGCAGCTCGGTGGAG
GTCTCCTACAAGGACGTCGCCTTGTGCGACGGCGAATGGCCTCAGTTTTA
CCAGCCGAGCAACAATGTCACGGTTTTCAAGACCTTGCTGAAAGGATCGT
CCATCGAGTTGACCAGCTCTATGCGCAAAGACCTGGTTGCTGCTCAGACG
AGTGGCAAGACGGTGCCGTTTAAGGTGAACTTAAGAGTGCCGGTTAAAAT
AAAAGTGGGGTCGGTTAAGACGTGGACGATTAAGGTAAAAGTGAGATGTG
ATCTAACGGTGGATAAGCTGACGTCTCAGTCGAAGATCGTATCTAAGGAC
TGNGATTACTCTGTCAAACTTTGG
back to top