DC900251

Overview
NameDC900251
Unique NameDC900251
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length555
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7454 contig Csv1_Contig7454:326..880. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900251 VSS Citrus sinensis cDNA clone VS28290 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900251 ID=DC900251|Name=DC900251|organism=Citrus sinensis|type=EST|length=555bp
CTCGGACAGAGCAAGGTTTATTATTCCTAGAAGTAGCGGTTCCTCGAACT
CCAATGGCAGCGACTCCTCTGATCAAACAGAGACACCTTTTGGATACACA
AGGAAGGATGTTTTATTGATTGGAGTCGGAGTTACTGTCATTGGATATGG
CTTAAAAAGTGGACTGGAGCTTTTTGGAGTTGATCCTTTGCAAGCTGGGA
ATGTTGTTGAGGTGATAGTAGTTTTAGGCCTTACACTTGGATGGGTTTCT
ACTTACATCTTTAGAGTCTCAAACAAGGAAATGACTTATGCTCAACAACT
ACGGGACTATGAAGACAAAGTCATGCAGAAGCGATTGGAGGGCTTGACAG
AAGCAGAGCTGGAAGCATTGATTGAACAAGTTGAAGAAGAAAAGAGACGT
CTAGCAAGTGGTGAGCAAGTTAATTGAACATCACTTCAATTATTATCACT
GTATCCTACTTTAAATTAGAAATTAAACAGTAATCAAAGCACAAGTCTCT
ATGTACATATCTTACAGATAAGTTTCTAATTTTTCCTTAATTCTAATTGG
CCTAG
back to top