DC900248

Overview
NameDC900248
Unique NameDC900248
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length151
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12943 contig Csv1_Contig12943:540..690. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900248 VSS Citrus sinensis cDNA clone VS28287 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900248 ID=DC900248|Name=DC900248|organism=Citrus sinensis|type=EST|length=151bp
CTGCTGTGGGCGTCAGGGATGTATAAGAGACATTAGAAAAATGCTCCGAG
GCTCTATTTGCCCGTAGGTTCTGTCTTTATATCCGTTGCGTGTACTGCTG
TCCTCCCCTACTGTCCTAATTGTTGTAATAAAATCAACTTAAAATTTCAT
C
back to top