DC900245

Overview
NameDC900245
Unique NameDC900245
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1148
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5647 contig Csv1_Contig5647:1..1148. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900245 VSS Citrus sinensis cDNA clone VS28285 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900245 ID=DC900245|Name=DC900245|organism=Citrus sinensis|type=EST|length=1148bp
TAGTCTCGAGTTTTTTTTTTTTTTTTTTTCATCAGGGGCAGTTATGTCAT
TCAATATCAGAAAACTCAGTCTCCATTACGTGAATATATCCCAATACTAC
AAATAACATTCAACACCTGGGTATTTACGTGAAATTACAGGGAACCCTTC
CCTAAAAACCCCCCATGAACTTTCTACGTAGTATCAAAAACTAAATACAT
CATAAAATGAACACAGAAACATAAAAACCACATTTTAAACCCACAGATCC
AAGTGAACAAAACAAAACTAATCACCGGAGTCGTCATCGCCGCCGAAGAT
CGAAACGCGGTTGTAGAGCAAGAACAAGATCAAAACGAGAAACAGCGCGA
CGCCGACGGGGGACCCGCTGACCCTGTGAATGGTGTCGGGCTCGCCGGTG
AAGAAAATGCTGTTGACGAAGGAGCCGCGATCGGAGGAGAGGAATTGGAT
CGTGAGGAGCAAGATGATGGGGAGCAAGAGAAGCCCTACCGGACTCAAAA
GCTCGGCTATGAACTCAGTTATGGCCTCGCCGGAGTCGCCGATGATGAAC
GGAACCAGCNCCNCGATGCCGACGACCACTGCCAGTAACACCCCGTGGGG
CGGGCCNCCGTGTGGTCTGTCTTCTATCANTGCTTTTGCTTTGTGAAAGG
TTTTGTGNTTTTGCCGTGNGNGTGTGNTTTTGCAAGTTCGAAGCTATCGA
TCNAACTGAAANAAATGGAGAAGACTACTCTCAAGNCCNTTTTCTTGGTG
ATCNCCTTATGCGTTGCAGCTGCATTGTATGATTCGTTCTTAATAGNGCC
AACGGCTGGAGCTAGGGTAATGAGCCAAGAATTTACATGNTCACATGACA
GTGAGTGCNTGCAGCGTTGTNAAGGTCATAAAAGCNAATGNATAAATGGG
AACTGCATTTGTGGGGGAGGNCCAAAACAGACTGNTCTTGACGCTATTTT
GCCNTCCGCTTGNTCTCGCAGCAGTGAATGCATCAAATTCTGCCCTCCCA
AATGTGGAATTGTTANATGCAATGGAGGAGTATGCTTTTGTGAGTGTTAG
NGCCTGGGATCGAAAGATGATACTAATATCNTTAAATAATAAATAAAGGC
TTCTTNTAAGCNTATTGGACTTCNATCTTTGAATAATAAGCCTCTGNC
back to top