DC900210

Overview
NameDC900210
Unique NameDC900210
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length800
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900210_ssr661 microsatellite DC900210_ssr661:661..674.
DC900210_ssr76 microsatellite DC900210_ssr76:76..87.
Csv1_Contig5851 contig Csv1_Contig5851:342..1141. BLAST: Citrus Unigene V1 Contigs to SwissProt
Properties
Property NameValue
Genbank descriptionDC900210 VSS Citrus sinensis cDNA clone VS28247 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900210 ID=DC900210|Name=DC900210|organism=Citrus sinensis|type=EST|length=800bp
TATCATTCCCCACCACCGCCCAAGAAACCATACGAATACAAGTCTCCTCC
GCCACCAACTCCAGTTTACCATTCCCCACCACCACCAAAGAAACCATACA
AATATAAGTCTCCTCCGCCACCAACTCCAGTTTACCATTCCCCACCACCA
ACGCCGGTTTATCATTCCCCACCACCTCCCAAGAAACCATACAAGTACAA
GTCTCCTCCACCACCAACTCCAGTTTACCATTCCCCACCACCACCCAAGA
AACCATACAAATACAAGTCTCCTCCGCCACCAACTCCAGTTTACCATTCC
CCACCACCGACGCCGGTTTATCATTCCCCACCACCTCCCAAGAAACCATA
CAAGTACAAGTCTCCTCCGCCACCAACTCCAGTTTACCATTCCCCACCGC
CACATCACCCTTACGTCTATGCATCTCCCCCTCCTCCTTACCACTACTAG
AAAGTGGACATGAATAGCTCATGCTTTTATGGAGAGGCTAATGGTATCCG
AATAAAGAAAGGGTTCGATGAAAAGCTTTACTGCGAGCAGGATAGCGATC
GATCCAGTTGCCGCGTTTGATTCTCTTTTATCTTTGTTTTCTACGAGGAA
TAAACAGCTACATGTAGAAACAGAAAAGTTCTTATCATTCTCATGTATCG
TGGATTTTAGGTGTGTGTGTGTGTCAATCGAATCTTAGGTGCATGTGTCT
TTTGTAATTTTCAACCTCTATGCATGCAAAATGCAAGAGCTTTTTCGTAC
AACAAAATTAATATACTTCCCAAGATGGTCCGTATGTTGTGGTTGATTTT
back to top