DC900204

Overview
NameDC900204
Unique NameDC900204
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length751
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900204_ssr42 microsatellite DC900204_ssr42:42..56. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1843 contig Csv1_Contig1843:17..767. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900204 VSS Citrus sinensis cDNA clone VS28241 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900204 ID=DC900204|Name=DC900204|organism=Citrus sinensis|type=EST|length=751bp
CAAAACCATAACTGAGAGATGGAAGAAAAATTATTTCTCTAAAGAAGAAG
AAGAAGAAAAATAGAGAATGAGATATGGTGGGGCTAAGTATAGTTTTGGA
AAACCAAAAGCATGGTGGTTTTAACAAGAAAAGCCCTCAAGTTATTAACA
AAGCCACTATGATTATTAACAACAAGCCTTCATTTTCTTCTGCATCATCA
TCAGACGCTGCAAATTCTCACTCAACTTTCCCAGTTCCCACTTTTCTTCA
GCATTGCTTTCTTTGCAAACAAACCCTTTTGCCTGGCAAAGACATTTACA
TGTACAAAGGGGATAGAGCTTTTTGTAGCGTGGAGTGCAGGTGCAGGCAA
ATATTCATGGACGAAGAAGAGAGCTTAAAGAAAGAGAACTGTTCGTTTGC
TGCTATGAATCCCAGAAGCACTTCATCTGCTGCTTCTGCTTCTTCTTCCC
GCCACCGTAAAGGAACCAGAAACCGAGCTGGTGGCTTCGTCTACTGATAT
TAAAAGGGAAAAAAAATTGTATCCCAGTTTTACCCTTAGCCTAATTTTGT
AATGACAATCTTGTACGCTGTCGTTTTGCTTCTGGATTTGTAGCCAAGAA
GCCATTTTTAACTTCCTTCTTTCTAAGCCCCACGTATCTATGGGGACTAT
GGGATCCCCTGGTTTGATTTGCTGTCAGTGTGTGGGGTTTTTTTGGCTCA
GGGCATTTCCGGTATTTAATTATATTAATGATATTAACGNGATTATTAGT
T
back to top