DC900203

Overview
NameDC900203
Unique NameDC900203
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length541
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900203 VSS Citrus sinensis cDNA clone VS28239 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900203 ID=DC900203|Name=DC900203|organism=Citrus sinensis|type=EST|length=541bp
AAAAAAAAAAAAAAAAAAAAAAAAACCTGAGATCCATGAAGCCTGAAGCC
AGCCTACTGCCTCTTTTGATGAAGCCTGCCTAAACCGGAAGACCAGATGA
ACCAGGGTTGACATTCTCATGGCCCACCCTCTTGCCTGTAATTAGAAGGA
CTAAATATATGTGGAGGACTTGTTTATTCACTGTTGAATTTGACATCTTT
TTGACACCAAATTTACCAAGCTCTACTCATTGTGCTCCCAAGAACCTACA
TAGCTGGCTGCCTATGTTGCTGCTTTATTTTGCTTTTATTTTCCCTAGTT
CACGTTCCTTTAGAAGTACAAAACCATGACTTCCATCCTCTGGAATTTGT
ATTAAATGTAGGCTTTGTTTATCTTCAGCTATGTTGTCTTGGTTTTAATA
GTTTTATTTTTTTACGGATTTGTTCTTTGACCTTTCCAGTTTCTGTGAAG
TAGCGGAATTAACATAACCCACATTGCTGGTATTGTTATTTTATTCTTGC
ATCAATCTAAAAGTAAGAATTATTGAACTGTGGTTGTGAGG
back to top