DC900199

Overview
NameDC900199
Unique NameDC900199
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1409
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900199_ssr1 microsatellite DC900199_ssr1:1..26. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig8208 contig Csv1_Contig8208:392..1814. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900199 VSS Citrus sinensis cDNA clone VS28236 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900199 ID=DC900199|Name=DC900199|organism=Citrus sinensis|type=EST|length=1409bp
TCTCTCTCTCTCTCTCTCTCTCTCTCCTCGTGCCGAATTCGGCACGAGCT
CGTGCCGAATTCGGCACGAGATCATCTAGAAGGTTAGGTCAGACTAACGA
GCCAGACTTATCTTTTGCTATTGTAAATGATTCTTTTGATGCTCAAAGGT
TCCATTCTGAGACCAGCACCAGGGAGGTTGAAGCTGATCAACATAAGCAG
GTTGATGGGCAGAACAACTTAAATGGTAAGGCCCCAGAAGTTCAGGAAAA
TTCCCAGCCTTCTGATTTGAATCATGGTCGGCAGCCTCGGAAGAGAGGCA
GGCCTAGAGTCAGTAGAACACGATCAGTGAAGGCAGTTGTCCAAGATGCG
AAGGCCATTCTTGGGGAAGGTTTTGAATTAACTGAGAGTGAGAATTTAAA
TGGGAATGCTGATGATTCTGTCCAAGAGGCTGCTGAAAGTCGGGGTGAAC
CTAGTCTAGATGATAAAGGAACATCCAGAAATGCACGAAAGCGGAACCGT
GCTCAGTCATCTCAAATAACGACAAGTGAGCACGATGTTGATGATAGTGA
AGCACAGTCAGGGAGTGTTGTGGTGGGCCAGCCCAGGAAGAGACGGCAAA
AAGTTGATCCAGCAGAGCAAACACCAGTTCCAACCCGATATAATCTNCGG
CGACCCAAAACAGGAGCCCCTGCTGCAGCTGNGTCTGAACCAACCAAGAA
AAGGAGAAGTGTCTGAAGGGTTCGAGGAGCCTTAGAAGATGAAATTGTCA
ACTCCAAAGCTGCTCCCCCAAATNCAGTGGGTGTCTTCAGCGACAATGGC
AGAAGCTCNCAATTAGTGAGGTCGACAACAAGGATGCATCAAAACAATTT
GTTGAGAATATGGCATTGACAATGAGCGAAGAAGTGAATGGAACACCGGA
AGGAGCAGGAGATTATGGTGATGCGGATGAGTTCAGGAGTGAATCCCCTG
GAGAAGATGCTTCTGGGTTCGATGGTGGTGATAGCGATGATGAGTGTGAA
CATCCTGGTGAAGCCTCAATAGGAAAGAAGATCTGGACTTTCTTCACAAC
ATAATGTTGCTGAGTTCTGTTCACCATTTTGATTGCATAAAATTTGTTAG
GTTTGCTGTTAGGATTTCTTTGAAAGAAGTGTAGTAATGTGTATTAACAA
TTTGAATGTAGTAATGACCGCGAGGTCTTTAATCTAGAGAATAAGGGGGT
TGGGAATTTGTTTGCCCTCTTACTTCTCTTCTTTAGAATTCGGATATTGG
TGGTGCTGTTTTAATCATTTTAGTACAGTCCTAGATAGATTTTAATGTGG
CAATGACCAGTGGCTATTTGTTTATGACGGGGGTGTAGCTTCCTCATTAC
CTCAGAACTTGCTTGTACCTAGAGTTTGTATTTCACGTTCTACGGCAATG
AATTGTTTG
back to top