CX043361

Overview
NameCX043361
Unique NameCX043361
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length953
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_10E11_b Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10E11-J22-1-7.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043361 ID=CX043361; Name=CX043361; organism=Citrus sinensis; type=EST; length=953bp
AAAAAATAAAAATGTAGTCAATACAAAAATATAACTAAAATTGTACTTTT
CGCGGCTTCAAATAATAAAATTCATCAATTATGGATTCTGGAACAATAGT
ATCTGCAATTTCTCTTTCAACATAGACAACCATACAATTTGAAAGAAACT
CATTTTCCATCTTATTGCGAAGTGATGTCTTGATAAGGCTCATGGCTGAA
AATGCACGCTCTGTTGTGGCTGTAGACACTGGAAGAGTCAACACTAGACG
AATTAATCTATCAATCAAGAAATAGTGTTGTGACTTCTTTGTTTCAATTA
ATCGTCGACATAACTCAGAAAGTGATGCAACTTGTTGAAAAAGTGGATGA
GAAAGCACATCAAACTTGTAATGCTCCAATTCTCTTCTCAAAGCAAAAAT
CTCATTTGCAGTGAAATCATGAGGATAAAATTTCTCAGCAAGACAACAAA
TACGATCTATATCAAATAATTTAAACCCATCGATTGGATCCAAAGCCGAG
CTTAGAGTAAGGAGTTCCATAGTTTGCTCTGGGAACCTGCTATTTATCTC
TGTCAATTGAAAATCTTCCATATAACGAACACTCATATCAGCCACACTAA
TGTCATGCTTTCCACAAAATGATTCCACACTTCTAACAAAATCATCCCAA
CCATTATCTCGAAATTCTTGCAAAAGCCTTTTAGTACTTGTGATATAATT
CAAAGCATTCAAGATGTCTAAAGATTTTGCTTGTAATGCTCGGCAAAGAA
TATCAGAGATCCCAAGAACTCTATGCAACAAAAGTAAAATGAACACAAAC
TCGAAGGATTTCATTTCTCTATACGCACTTTTAGCTTCTCCACGCATATC
TCGACTGGGCCCATCATTAATCATCTTTCTTAGAACTTCAAGAGTTGCAC
CAAACATCTCAATAAGGGGTGTCAATACTAGTTTGAGTATCAACTTTCTC
AAA
back to top