DC900192

Overview
NameDC900192
Unique NameDC900192
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length652
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig785 contig Csv1_Contig785:537..1188. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900192 VSS Citrus sinensis cDNA clone VS28228 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900192 ID=DC900192|Name=DC900192|organism=Citrus sinensis|type=EST|length=652bp
CAATGAGATGGGGATTCTTTATCAGGAAGAAAGCAGCTGAGAGGCGAGCT
CAGATTGTTGAGTTAGAAGATGAATAATGTCTGGGTTCTGTTATCAAGCC
TCTTTCTACGGCTCTTCTTTATTCTGTAAGTTACAAGAACTCTTGGGGAG
CCAGTGACAAATTGAGGTTTTTAGATCCATAATTCTCAAGTGCCTTTGGT
GTTTTTGGATTCTTATTAACNCCTTGATGACCTCTGGTACTCGAAGGTTC
TTGTTAGGCAATGGGAAAGCTCATCTTGTACAGTGGCCTGTACAGTAAGT
TGTTTATATAGTTATTCTTCATCCTTGGTAGTATGTTTCTCNCTACTACT
TAATGAAGTTGTTTAAGTATGATACCTGGGCTTAACTTTAAGTTCCCGAG
GGGTAATTTGTTTTTGGGTTGATGAGCCCTTTTGCTCTTGTTGACTAATT
GGGGAAACATTTCTGGTATTTAGGCATGACTTCATTTGTTGTCTGGACAA
ATTTACTTTGTTAGTGTGATGCTTTACTATTTTCTTGTATGTGCTAGATA
CCCTTTCTCATTGTTCTTTTTCATATAATTATGAAAAATGATTGGTATTT
ACAGATGAAGACCGAAATCACATGTCTCCAATAACATAATTTTTATAAGC
AT
back to top