DC900185

Overview
NameDC900185
Unique NameDC900185
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length882
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900185_ssr347 microsatellite DC900185_ssr347:347..358.
Csv1_Contig11753 contig Csv1_Contig11753:49..930. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900185 VSS Citrus sinensis cDNA clone VS28214 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900185 ID=DC900185|Name=DC900185|organism=Citrus sinensis|type=EST|length=882bp
AACGCAGCTGCTTTTGCTTCTTTTCTTCAGTTTTAGAGCTTCAAATCTTC
AGATCTCGCCCCTCCTCCCTCAGATCTCCGTCTCCGGTTTTTTTTTTTAG
TTATTTGTTTGTCTGTTCTTTGCCGTACAAATGGCGAGTCGCCACGGTTC
AGTGACAGTAACGGTCAATAACGGTTCGGTAACCTGCACGGTGCAGGCGC
TCGTGACTTGGCTAGTTTCGTCTCTGGTCAAAGCTCAACTCTTAACAGCG
CAGGATCTCTTTTGGACCTTGCTGACTATGAAACCTAGAATCAAGGAAGA
TCCAGAAACCCAAGGCAAACCATCTGATGCAGAGGGGGATGATGGCGATG
ATGATGATGGGGATGATGATGAGGATGGAGATGGTGGGTTTGGGGATGGT
GAAGAGGAGTTATCATCTGAAGGGGACTATGGCAACAATAACTCCAACAA
CAAGAAAAGTAACTCCAAGAAAGGTCCTGGAGAAGGGGCCGGGGCAGGGG
CAGGGGCAGGCGGTGCCGAAGAGAATGGTGAAGAGGAAGACGATGAAGAT
GGAGAGGGTGAAGAGCAAGATGATGACGATGACGATGATGAGGATGATGA
CGACGACGATGATGGGGGCGAGGACGAGGATGAGGATGAAGTGGAAGAAG
TAGAGAATGAAGAGGATGAGGAAGACGAAGATGATGAAGCTCTTCAGCCA
CCAAAGAAGAGGAAGAAGTGAACTAGATAAATGGCAGGGCCTCCTCCGAA
ATACTGTCTCTTTGTGACTTGTATTAACTTTCTATGATTATGTTTAGCTT
ATGAGGGGGCCATTTTTAGGGTAATGGTTTTAAGCATAATTCTCTTATTT
CCTTGTACGATTTAGAGTAATGTAGAACTTCG
back to top