DC900182

Overview
NameDC900182
Unique NameDC900182
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length388
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900182_ssr355 microsatellite DC900182_ssr355:355..378.
Properties
Property NameValue
Genbank descriptionDC900182 VSS Citrus sinensis cDNA clone VS28208 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900182 ID=DC900182|Name=DC900182|organism=Citrus sinensis|type=EST|length=388bp
CCATATGTCGAAGAGGCATTACTTGCTTCCCAAGAAATTTCAGCATCGTA
CTCCGAAAAGGAAGTGTCCCCTGCTGAAGCGCCTAGTCCTAGCCCTGAAG
AGCCAATTATCAATATCAGGGCGTCCCCTGTGGAAGCTCCGGGGCCTAGA
TCTACAAAGGATGAAAAATATCCCTTTTCGCATAAAGAATCTCCGGAGGA
AATGTCTCTTCCACATGAAGAAAAGGCTTATCCGAAAAGAAAGTGGGCTA
CTTCTGGGCCATCTTTTCACTTTGATAATATGAACTGATGCAGCTGAAAA
AAATAATGCTTCAAAATTAGCTTACCTTTTTAGTTGTAGCTTTTGACTTT
GATGATAATAATAATAATAATAATAATAAGCTTGCGCG
back to top