DC900181

Overview
NameDC900181
Unique NameDC900181
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length527
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig329 contig Csv1_Contig329:13..539. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900181 VSS Citrus sinensis cDNA clone VS28207 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900181 ID=DC900181|Name=DC900181|organism=Citrus sinensis|type=EST|length=527bp
CTCGTGCCGAATTCGGCACGAGCTTCAGCTCAGAGCCTCAGACCCATAAG
AAGGAAACGCTTAACCAAAGCATCAGATGGCGCCTCCTCCTGGTCCCTAC
TCCGGTACCAGCACCCTTGCCTTGGTCGCTCGGGTTTCGGCTTTTTCGTT
CGGGCTTGTTTATGGGAACATTAAGCTCAAGTACCTCAAGTCCAAGGCAA
AATCTCTCAAAAAAGCTGAAGCAAAGGGTCATCATTGAAGATGACTGGAT
CTGTTTTGAGTTGAGTGCGCATTTGAGAGTTGGATATAGGAATAATTGTT
AATGAACCTAGCAATCTTTCGTTTTTGGCGTATGGGTGGCATTTGCAGGC
CTTGCTCTATGCTCTGTACCTGTGAAATTTTTTTGGTTAATCCTTTGAGA
AATTTCACTTGATTGGCTATGGCCGTAACCGTGGATTTGAACTTCCATTT
CAGTTAGTTTTTTTGCTGAATGATTTTACATCCTTTCCTGGATCAGATTA
ATAAAGTCTTAATTCTATTGAAGCCTC
back to top