CN186135

Overview
NameCN186135
Unique NameCN186135
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length767
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2525 contig Csv1_Contig2525:1..767. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002G18_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002G18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186135 ID=CN186135|Name=CN186135|organism=Citrus sinensis|type=EST|length=767bp
TTTTTTTTTTTTTTTGATTAATGAAATGATTGAAAGAATTCAACTTCATT
TCAAGGCAGCAACTCAAAAGAGTTTGCAATTTATTTTCCCTTGATCATTC
AGGGTTACTCAAAACAAAAAACAAAAACGCAAAAAAGCCAATACAAGTGA
CTGATAATCCAACATTACACAGTTCAATTTCACAGAAGTAGATGAAACTG
AGGAGAGGATTCATGATCATTAGCAATGATGAATCTTTCCTTAAATTAAG
TAAAAGCAATTTAATGGGAAGGGATCTTAAACATGAGGGACTTATTAATC
CATGCCTTCCAACTCCCGCTTCCACTTCCTCTACGAGCAATGGCATTGTC
CAATCTTCCATTCTCTGCTGTTTTCTCTGTTTGCTGCTTCTTGCATAGCA
AAAAGTTACGCATTCCATGTCTTCCAATTGTGTCCCAAGGGCTCAGTGCA
CCAGACCCAGCATTTGAACAATAGAGAACGAAATCGTTGAGATCAGAGCC
GAGAACGGGAAGCCTCCCTTCACGAGCATAAGATTTCAAAGCGGTATCAA
TAACAGCAGCAACAAGCTCTTCTTCATTCACCACAAAACGGATCGGGCCA
GCGCTTCCCAGCACAGTAATGCTGATCAAGATCCTGTTTCCCTTGGCAGC
TTGAGCCTTCTTTTGCTTGTACAACAACATTGTCGCAAAATTTAATTAAG
ATCTAAACAAAAACTCTTGAATTGGGGGTTTTTTTATTTTTAAAAAAATC
TGATTTTTATCTCTTCT
back to top