CN186131

Overview
NameCN186131
Unique NameCN186131
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length203
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0002G16_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002G16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186131 ID=CN186131|Name=CN186131|organism=Citrus sinensis|type=EST|length=203bp
TTTTTTTTTTTTTTTTTGCAAAACTTTCATTTAATTCCCATCATTTTCTG
CAACAAACGAACAAAAATCCAAATATTGTACAAATTACTAAATACCACGG
GGCCCCCCCAAGTTCGTTTTCTGGGGATTACTAGTGGGCGTAATACATGG
GGATAATAATGAAAAGCCAGCAAATCATCGATCTGACCTCTGATTAATCA
CCT
back to top