CN186129

Overview
NameCN186129
Unique NameCN186129
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length820
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2524 contig Csv1_Contig2524:1..821. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS05_0002G15_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002G15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186129 ID=CN186129|Name=CN186129|organism=Citrus sinensis|type=EST|length=820bp
TTGATTGACAATATTTTCTTTCAACAGCTTTTCCTTCATCCTCTTCGTGT
CCCTTGAAAGATTTTGCCAACACACCATATGGCTCTTTCGGCGTTTGAAA
TGGCTCTTTCCGATCAATTGGCAACGGCGCTTGAAGATATCTCGAGAGAG
GAAGTAGGATCTTGGCTTTTTCGTTATTCTTCGCTGGCGACGACAAGAAT
AATCGGAGCGACGACCGATTACGCTGAAGATGATGGAAATCCCAATTGTA
CCGAAAAAGATGAAATCAGGAAGGGATCTATTTCCGACCTCAAACGCAAA
GTTGTTCGTATAGGATTTCTGTCATGGTCGAAGTTGATTGATAGTCGAAC
TAGGGCAGAGAAATTGCATACGGATCTCGTCAATTTGAAGAATTCAAGAA
ACGGGTCTTCACACAAAGCTAATTGTAAGGAATCTTCATTTGAAAATTTG
CCTGTGTTGTCGACTATGGACAGGGAGACGGTCTCTGATTCCTGTCATGC
TCAAGATGAAAAAATCAGAATGGCATATATTAATCCCATTCCCGAGTTCC
AATTCCAAGACCCAGCTGATCCGCGCTTGGAGTTGTTGTTTCTGCAAGTG
GAAATACCTTCTTTGTCATTAGGACAAACCCATGTTTCACGAGTTTGGTA
CGATTGGAAGAGGCCGTCTTTATCTGAAATGAACCTTCCAACTGAACCTC
GGGTAAATCTCTGTACTGAACGTCTGGAGTTAGAGTTGGGTAAACTTCTG
GCCGTCGAACGCAAGAATTCAAGAAAGTGGCCTGATACGCTGCCTCAAGT
GGATAAACTCTTGGTACATG
back to top