CN186119

Overview
NameCN186119
Unique NameCN186119
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length759
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS05_0002G09_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186119 ID=CN186119|Name=CN186119|organism=Citrus sinensis|type=EST|length=759bp
GCGGTTTAACTTAAAACCCTTCACCGCGGTCCGGGATCAGTTCGAATAAG
CAATGGAAATTTCAACAGAAGCAAAACTTGAACCTTTCCTTCAATGGCTG
CAGGTAAATAAAGTTGAATTACGTGGCTGCAAAATCAAGTACAGTGATGA
AAGTAAAGGATTCGGTATCTTTTCATCGAATGAATTTTCTGACGGGGTCC
TACTAGTTGTTCCGTTAGATTTGGCTATAACACCAATGCGAGTATTGCAA
GACCCTCTTATTGGCCCAGAATGTAGGGCAATGTTTGAAGACGGAGAAGT
AGATGATAGGTTCTTGATGATTTTGTTCCTAACCGTGGAACGCCTCCGTA
AGAACTCTTCATGGAAGCCGTATCTTGATATGCTTCCTACTACTTTTGGA
AATCCACTATGGTTCACAGATGATGAGCTTTTGGAGCTTAAGGGGACAAC
ATTGTATCGCGCAACTGAATTGCAGAAGCAAAATTTGTTAACTTTGTATG
ATGACAAAGTGAAGGACTTGGTGAAGAAACTTTTAGTTCTGGATGGGGAT
TCAGAAAGTGAGGTCTCTTTTGAAGATTTCCTTTGGGCAAATTCTATATT
TTGGACTCGTGCGCTGAATATTCCTCTTCCACATTCCTATGTTTTTCCAC
AAAATCAAGAAGATCTGAACAAGTATGACTCAATTAACAACAGTGCTGAG
CTTTCCAATGATCATAATTCACGTGGAGAGTTGATTAATGGACTGAATGA
CATAAAAAA
back to top