CN186075

Overview
NameCN186075
Unique NameCN186075
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length709
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2520 contig Csv1_Contig2520:2..710. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002F07_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186075 ID=CN186075|Name=CN186075|organism=Citrus sinensis|type=EST|length=709bp
CTTTTTTTTGCATGCTTTCTGCAATAACGATGATGATAACAGCGAACAGT
TTACCTTTTGACTTATTGTAGAAATACATAGCTCAATAAAATGTTGTGTA
CAATGAGATTAAACTTTAATGGCAGCGGTTTCCACCAAAGTCAAATTTGT
CAACAGGTAAATATCCAAGCTAACCAGAACTCCAATCACTGGGGGTTCCA
CCTCTCAAATTGTGACTCATGGCAATGTGGGTCAAGCCAATCCCTATTAG
AACCCTTTGACATGTTGGCACTTACTCTTCCGCCACCACCCACAAGCTCT
CGCAGATTTTCCACCTTATTCTCCCGCCCAGGCCCACTTGTCCTCCGGTC
AGCTTCCTTCAGTTTCTGTTTAAATCGTTGCTTTCGGCTAGAGGAGTTCA
ACTCCTGATGCTTTGGATGTGAAGGTGGGGCACCATGCGGTCCTAGATAG
ATGTTCTCTTCTTTTTTACCCTTTGGGGAAGGAGGTTTCGAACTTTCCAC
TTCTACAGCATCTCGTTTACTTTGATCTGAGTCCCCTATTCCCAAGCTTG
GAATCACAAATCCATCCGTGTCCCACTCGTCTTCTTCTTCGATCTGAGGA
GTGGTGTGCACTGGAGAGGGTTCCATTGGACGCTGACGATCATGGATTTC
AATGGCCAAAGGGCGATAAAGCCCGGATGGGGAGCGAGATCAGATCAAAA
TCAATCACC
back to top