DC900134

Overview
NameDC900134
Unique NameDC900134
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1028
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10695 contig Csv1_Contig10695:876..1903. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900134 vs. ExPASy Swiss-Prot
Match: FATB_GOSHI (Myristoyl-acyl carrier protein thioesterase, chloroplastic OS=Gossypium hirsutum GN=FATB1 PE=1 SV=1)

HSP 1 Score: 397.897 bits (1021), Expect = 4.986e-110
Identity = 190/256 (74.22%), Postives = 220/256 (85.94%), Query Frame = 3
Query:    3 LMTHLQETALNHVMTAGLLDAGFGATPAMAKKNLIWVVTRMQVVVDRYPTWNDVVNVETWVSASGKNGMRRDWLIRNAKTGETLTRATSLWVMMNKLTRRLSKMPDGVRQEIEPYFLNSDPVVDEDSRKLPKLGDSTADYVRRGLTPRWSDLDVNQHVNNVKYIGWILESAPQQILESHQLASVTLEYRRECGRDSVLQSLTAVSDKDIGNLVNLGSVECQHLLRLEEGAEVLRARTEWRPKDAHNFGNVGPIPAE 770
            LM HLQETA+NH  +AGLL  GFGATP M KKNLIWVVTRMQVVVDRYPTW DVV V+TWVSASGKNGMRRDWL+ N++TGE LTRATS+WVMMNKLTRRLSK+P+ VR EIEP+F+NSDPV+ EDS+KL KL DSTA++V +GLTP+WSDLDVNQHVNNVKYIGWILESAP  ILESH+L+++TLEYRRECGRDSVLQSLT VSD +  N VN+G   CQHLLRL++GAE++R RT WRPK A +  N+  I A+
Sbjct:  156 LMNHLQETAINHCRSAGLLGEGFGATPEMCKKNLIWVVTRMQVVVDRYPTWGDVVQVDTWVSASGKNGMRRDWLVSNSETGEILTRATSVWVMMNKLTRRLSKIPEEVRGEIEPFFMNSDPVLAEDSQKLVKLDDSTAEHVCKGLTPKWSDLDVNQHVNNVKYIGWILESAPLPILESHELSALTLEYRRECGRDSVLQSLTTVSDSNTENAVNVGEFNCQHLLRLDDGAEIVRGRTRWRPKHAKSSANMDQITAK 411          
BLAST of DC900134 vs. ExPASy Swiss-Prot
Match: FATB_CUPHO (Myristoyl-acyl carrier protein thioesterase, chloroplastic OS=Cuphea hookeriana GN=FATB1 PE=2 SV=1)

HSP 1 Score: 340.502 bits (872), Expect = 9.447e-93
Identity = 162/243 (66.67%), Postives = 199/243 (81.89%), Query Frame = 3
Query:    3 LMTHLQETALNHVMTAGLLDAGFGATPAMAKKNLIWVVTRMQVVVDRYPTWNDVVNVETWVSASGKNGMRRDWLIRNAKTGETLTRATSLWVMMNKLTRRLSKMPDGVRQEIEPYFLNSDPVVDEDSRKLPKLGDSTADYVRRGLTPRWSDLDVNQHVNNVKYIGWILESAPQQILESHQLASVTLEYRRECGRDSVLQSLTAVSDKDIGNLVNLGSVECQHLLRLEEGAEVLRARTEWRPKD 731
            +M HLQETALNHV  AGL + GFG TP M K++LIWVV +MQV+V+RYPTW D V V TWV+ SGKNGMRRDWLI +  TGE LTRA+S+WVMMN+ TRRLSK+PD VR EIEP+F++S PV+++D RKLPKL + TAD +R+GLTPRW+DLDVNQHVNNVKYIGWILES P ++LE+ +L S+TLEYRRECGR+SVL+SLTA+     G     GS + QHLLRLE+G E+++ RTEWRPK+
Sbjct:  160 VMNHLQETALNHVKIAGLSNDGFGRTPEMYKRDLIWVVAKMQVMVNRYPTWGDTVEVNTWVAKSGKNGMRRDWLISDCNTGEILTRASSVWVMMNQKTRRLSKIPDEVRNEIEPHFVDSPPVIEDDDRKLPKLDEKTADSIRKGLTPRWNDLDVNQHVNNVKYIGWILESTPPEVLETQELCSLTLEYRRECGRESVLESLTAMDPSGGG----YGS-QFQHLLRLEDGGEIVKGRTEWRPKN 397          
BLAST of DC900134 vs. ExPASy Swiss-Prot
Match: FATB_UMBCA (Lauroyl-acyl carrier protein thioesterase, chloroplastic OS=Umbellularia californica GN=FATB1 PE=1 SV=1)

HSP 1 Score: 309.301 bits (791), Expect = 2.332e-83
Identity = 152/256 (59.38%), Postives = 187/256 (73.05%), Query Frame = 3
Query:    3 LMTHLQETALNHVMTAGLLDAGFGATPAMAKKNLIWVVTRMQVVVDRYPTWNDVVNVETWVSASGKNGMRRDWLIRNAKTGETLTRATSLWVMMNKLTRRLSKMPDGVRQEIEPYFLNSDPVVDEDSRKLPKLGDSTADYVRRGLTPRWSDLDVNQHVNNVKYIGWILESAPQQILESHQLASVTLEYRRECGRDSVLQSLTAVSDKDIGNLVNLGSVECQHLLRLEEGAEVLRARTEWRPKDAHNFGNVGPIPAE 770
            +M H+QE  LNH  + G+L  GFG T  M+K++L+WVV R  V V+RYPTW D V VE W+ ASG NGMRRD+L+R+ KTGE LTR TSL V+MN  TRRLS +PD VR EI P F+++  V D++ +KL KL DSTADY++ GLTPRW+DLDVNQHVNN+KY+ W+ E+ P  I ESH ++S TLEYRREC RDSVL+SLT VS    G     G V C HLL+LE G+EVLRARTEWRPK   +F  +  IPAE
Sbjct:  129 VMNHMQEATLNHAKSVGILGDGFGTTLEMSKRDLMWVVRRTHVAVERYPTWGDTVEVECWIGASGNNGMRRDFLVRDCKTGEILTRCTSLSVLMNTRTRRLSTIPDEVRGEIGPAFIDNVAVKDDEIKKLQKLNDSTADYIQGGLTPRWNDLDVNQHVNNLKYVAWVFETVPDSIFESHHISSFTLEYRRECTRDSVLRSLTTVS----GGSSEAGLV-CDHLLQLEGGSEVLRARTEWRPKLTDSFRGISVIPAE 379          
BLAST of DC900134 vs. ExPASy Swiss-Prot
Match: FATB_CINCA (Myristoyl-acyl carrier protein thioesterase, chloroplastic OS=Cinnamomum camphora GN=FATB1 PE=2 SV=1)

HSP 1 Score: 309.301 bits (791), Expect = 2.332e-83
Identity = 154/258 (59.69%), Postives = 188/258 (72.87%), Query Frame = 3
Query:    3 LMTHLQETALNHVMTAGLLDAGFGATPAMAKKNLIWVVTRMQVVVDRYPTWNDVVNVETWVSASGKNGMRRDWLIRNAKTGETLTRATSLWVMMNKLTRRLSKMPDGVRQEIEPYFLNSDPVVDEDSRKLPKLGDSTADYVRRGLTPRWSDLDVNQHVNNVKYIGWILESAPQQILESHQLASVTLEYRRECGRDSVLQSLTAVSDKDIGNLVNLGSVECQHLLRLEEGAEVLRARTEWRPKDAHNFGNVGPIPAEST 776
            +M HLQE ALNH  + G+L  GFG T  M+K++LIWVV R  V V+RYP W D V VE WV ASG NG R D+L+R+ KTGE LTR TSL VMMN  TRRLSK+P+ VR EI P F+++  V DE+ +K  KL DSTADY++ GLTPRW+DLD+NQHVNN+KY+ WILE+ P  I ESH ++S T+EYRREC  DSVLQSLT VS    G     G V C+HLL+LE G+EVLRA+TEWRPK   +F  +  IPAES+
Sbjct:  129 VMNHLQEAALNHAKSVGILGDGFGTTLEMSKRDLIWVVKRTHVAVERYPAWGDTVEVECWVGASGNNGRRHDFLVRDCKTGEILTRCTSLSVMMNTRTRRLSKIPEEVRGEIGPAFIDNVAVKDEEIKKPQKLNDSTADYIQGGLTPRWNDLDINQHVNNIKYVDWILETVPDSIFESHHISSFTIEYRRECTMDSVLQSLTTVS----GGSSEAGLV-CEHLLQLEGGSEVLRAKTEWRPKLTDSFRGISVIPAESS 381          
BLAST of DC900134 vs. ExPASy Swiss-Prot
Match: FATA_CORSA (Oleoyl-acyl carrier protein thioesterase, chloroplastic (Fragment) OS=Coriandrum sativum GN=FATA PE=2 SV=1)

HSP 1 Score: 213.001 bits (541), Expect = 2.275e-54
Identity = 113/258 (43.80%), Postives = 158/258 (61.24%), Query Frame = 3
Query:   15 LQETALNHVMTAGLLDAGFGATPAMAKKNLIWVVTRMQVVVDRYPTWNDVVNVETWVSASGKNGMRRDWLIRNAKTGETLTRATSLWVMMNKLTRRLSKMPDGVRQEIEPYFLNSDPV--VDEDSRKLPKLG--DSTADYVRRGLTPRWSDLDVNQHVNNVKYIGWILESAPQQILESHQLASVTLEYRRECGRDSVLQSLTAVS-DKDIGNLVNLG--------------SVECQHLLRLE-EGAEVLRARTEWRPK 728
            LQE   NH  + G    GF  TP M K +LIWV  RM + + RYP W+DVV +ETW  + G+ G RRDW+I++  T E + RATS WVMMN+ TRRL K+ D VR E   +   +  +   +E+++ L K+   +  A + R GL+PR +DLD+NQHVNNV YIGW+LES P+++L +H+L ++TL+YRREC  D V+ SLT+   D+D      +G              S++  H LR+  +G E+ R RTEWR K
Sbjct:  108 LQEVGGNHAQSVGFSTDGFATTPTMRKLHLIWVTARMHIEIYRYPAWSDVVEIETWCQSEGRIGTRRDWIIKDFATDEVIGRATSKWVMMNQDTRRLQKVSDDVRDEYLVFCPKTPRLSFPEENNKSLKKISKLEDPAQHSRLGLSPRRADLDMNQHVNNVAYIGWVLESIPKEVLYTHELETITLDYRRECQHDDVVDSLTSPEVDEDTAVTKIIGTNGHAAAATEARDDSLKFLHFLRVSGQGLEINRGRTEWRKK 365          
The following BLAST results are available for this feature:
BLAST of DC900134 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 5
Match NameE-valueIdentityDescription
FATB_GOSHI4.986e-11074.22Myristoyl-acyl carrier protein thioesterase, chlor... [more]
FATB_CUPHO9.447e-9366.67Myristoyl-acyl carrier protein thioesterase, chlor... [more]
FATB_UMBCA2.332e-8359.38Lauroyl-acyl carrier protein thioesterase, chlorop... [more]
FATB_CINCA2.332e-8359.69Myristoyl-acyl carrier protein thioesterase, chlor... [more]
FATA_CORSA2.275e-5443.80Oleoyl-acyl carrier protein thioesterase, chloropl... [more]
back to top
Properties
Property NameValue
Genbank descriptionDC900134 VSS Citrus sinensis cDNA clone VS27V53 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900134 ID=DC900134|Name=DC900134|organism=Citrus sinensis|type=EST|length=1028bp
CATTAATGACTCATTTACAGGAAACAGCGCTTAATCATGTTATGACTGCT
GGTCTTCTAGATGCTGGCTTTGGTGCAACCCCAGCGATGGCTAAAAAGAA
CCTGATATGGGTGGTTACTCGGATGCAGGTTGTTGTAGACCGCTATCCCA
CTTGGAATGATGTTGTAAATGTAGAAACTTGGGTTAGTGCATCTGGAAAA
AATGGTATGCGGCGTGATTGGCTCATTCGCAATGCTAAGACAGGTGAAAC
ATTAACAAGAGCAACCAGTCTGTGGGTAATGATGAATAAACTGACTAGGA
GGTTGTCCAAAATGCCCGATGGAGTTCGTCAGGAAATTGAACCGTATTTT
CTGAATTCTGACCCTGTTGTCGATGAGGATAGCAGGAAATTACCAAAACT
TGGCGACAGTACTGCAGATTATGTTCGTAGAGGTTTAACTCCTAGGTGGA
GTGATTTAGATGTCAACCAGCATGTCAATAATGTGAAGTACATTGGCTGG
ATCCTAGAGAGTGCTCCTCAGCAGATCTTGGAGAGTCATCAGCTGGCATC
TGTGACCCTGGAGTATAGGAGGGAGTGCGGAAGGGACAGTGTGTTGCAGT
CCCTGACTGCTGTCTCAGACAAGGACATTGGCAATTTGGTGAACTTGGGC
AGTGTGGAGTGCCAGCACTTGCTCCGACTAGAGGAAGGTGCTGAAGTTTT
GAGAGCAAGGACTGAATGGAGGCCAAAGGATGCCCACAACTTTGGGAATG
TTGGTCCAATCCCTGCAGAAAGCACTTAAAACCCAAGTTTCTCGGAGATG
CGGTGGTCGCGCTGCCGTGTGTCACATTGCTCGTGTAGAATGCTGTGTGC
TCTTGGATCTATATATGTTCGCTTATATATTTAAAAATATATATCTATAT
ACACATATCTTATTCATCTTCTTTCTTTAAAAAAAAAAAAAGGTTGTAAG
TTTCATTGTAATTAGCGTTTGCTGCGCTGTGTTTCTCGCTCCCTGCATTG
CCGAATCAATTAGCTAGCTGCTGAGGAT
back to top