DC900122

Overview
NameDC900122
Unique NameDC900122
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length529
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900122_ssr499 microsatellite DC900122_ssr499:499..516. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5639 contig Csv1_Contig5639:1..529. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900122 VSS Citrus sinensis cDNA clone VS27V39 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900122 ID=DC900122|Name=DC900122|organism=Citrus sinensis|type=EST|length=529bp
CAGAACAAAAAATGAACGCCACTTCCACTTCAACAGACGTCGCTGAAGAG
ATGAACGGTGGAAGCGACTCGGACGACAATGCGCCGGAATACTACCAGCC
AATCTCCGTTCAGGATCCAGATTCAGATTCAGATGCCGATCAGATAAGCT
CATTACGCGTGTGACGCTGGCACCCTGCCCAACGGTTATTACGAAGCGGA
GGTGGAGCATCTAAACGGCGACGTGGAAGCAAAAAGCAGCAGCGAAGCGG
AAGATGAAGAGGAGGAGAGGATCAGAGAGGAGTCGGCGTTGGCGATGAGG
CGAGCGTTCAGAGAGGATGAGAATCGAAGAAATGCTCCGTTGAGTCAAGA
GAATGCGAGGCGAGTGATGGATGCCATGCGCCGCGTTTCCTTTCGCGGCT
TGGCCCCTGATTGGGCTAATCGCCTTTCTGAGGATCGTTGGATGGATCAG
TTGTCCAGGATCAGGCTACAACAACCCTCCACGTCGTCAACCAATAACAA
TAATAATAATAATAATATTTCATCATAAT
back to top