DC900115

Overview
NameDC900115
Unique NameDC900115
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1050
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5638 contig Csv1_Contig5638:1..1048. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900115 vs. ExPASy Swiss-Prot
Match: RN217_HUMAN (Probable E3 ubiquitin-protein ligase RNF217 OS=Homo sapiens GN=RNF217 PE=2 SV=2)

HSP 1 Score: 71.633 bits (174), Expect = 8.441e-12
Identity = 33/93 (35.48%), Postives = 47/93 (50.54%), Query Frame = 3
Query:  192 VECPVCERFICVECGVPWHSSLSCEEYQNLPLEERDAGDITLHRLAQ-----NKRWRRCQQCRRMIELTHGCYHMTC-WCGHGFCYSCGAEYR 452
            ++CP C+   C +C  PWH  ++C+EY+         GD  L   A       +  ++C +C+  I+ T GC HMTC  C   FCY CG  YR
Sbjct:   81 IQCPTCQFVWCFKCHSPWHEGVNCKEYKK--------GDKLLRHWASEIEHGQRNAQKCPKCKIHIQRTEGCDHMTCSQCNTNFCYRCGERYR 165          
BLAST of DC900115 vs. ExPASy Swiss-Prot
Match: RN217_XENLA (Probable E3 ubiquitin-protein ligase RNF217 OS=Xenopus laevis GN=rnf217 PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 1.102e-11
Identity = 33/93 (35.48%), Postives = 45/93 (48.39%), Query Frame = 3
Query:  192 VECPVCERFICVECGVPWHSSLSCEEYQNLPLEERDAGDITLHRLAQ-----NKRWRRCQQCRRMIELTHGCYHMTC-WCGHGFCYSCGAEYR 452
            ++CP C+   C  C  PWH  ++C EY+         GD  L   A       +  ++C +C+  I+ T GC HMTC  C   FCY CG  YR
Sbjct:  113 IQCPSCQFIWCFRCHAPWHEGVNCREYKK--------GDKLLRHWANEIEHGQRNAQKCPRCKVHIQRTEGCDHMTCSQCNTNFCYRCGERYR 197          
The following BLAST results are available for this feature:
BLAST of DC900115 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 2
Match NameE-valueIdentityDescription
RN217_HUMAN8.441e-1235.48Probable E3 ubiquitin-protein ligase RNF217 OS=Hom... [more]
RN217_XENLA1.102e-1135.48Probable E3 ubiquitin-protein ligase RNF217 OS=Xen... [more]
back to top
Properties
Property NameValue
Genbank descriptionDC900115 VSS Citrus sinensis cDNA clone VS27V29 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900115 ID=DC900115|Name=DC900115|organism=Citrus sinensis|type=EST|length=1050bp
TTTCCACTGCCGAGTGCAAATCGTTTCTGCCACTCAGTTCATATGAATCA
TTGGAGACAGCCCTTGCAGAAGCAAATATCCTCCACTCAGATAGAATCTA
CTGCCCCTTTCCTAATTGTTCTGTCCTGCTTGATCCTCGTGAATGTTTGT
CANCTAGGGCAAGTTCATCAAGTCAGTCTGATAATAGCTGTGTTGAGTGC
CCAGTTTGTGAAAGATTTATCTGTGTGGAATGTGGGGTTCCTTGGCATTC
TTCATTGAGCTGTGAAGAGTACCAGAATCTCCCTTTGGAGGAGAGAGATG
CAGGGGACATAACCTTGCATCGGTTGGCACAAAACAAAAGGTGGAGGCGT
TGCCAGCAGTGCCGCAGGATGATTGAGCTCACTCATGGTTGCTATCACAT
GACCTGCTGGTGTGGACATGGGTTCTGCTATTCTTGTGGTGCTGAATATA
GAGACGGCCAACAGACCTGCCAATGTGCCTTTTGGGATGAAGACAATTCA
GAAGAGTTGACCCAATCTGTCCATGAATCAGAACAATCAGCTTGGGAAAC
TTTCAATTCTCTCCCCATGATTATGGATGCTTACTCAGACCAAGAAAGAT
CACAGCTGGCGCTAATCCAAAGATTCCTTGCTGGCGGTTTCAGTCTTAGT
GATCATCATCCTTACCAATCACCACCCCGCTGTACAGACTCTTATGGGAG
ATGCAATGGAAGGATCTTCATCAACTTCCTTGGCTTGAAAGGTTCGTCTC
TGTGATAAGTGATACCTACTATGAAGATTATATGCAGTGAAGCAGATAAA
AGATTACTCTGAAATCACATGAACATAAGTTGATGAGCGCTACCGAGAAT
GCTTTTTANAGGAGGTCGGAGAGCTTCTCGCTCTTTCACTCCCATTTTTC
CTTACACGGGCATGTAAAAATGGATGCTCTTTCTTACCATGNAANNTTAG
TCATTAGCTGCTGAAAAAATTGTGGCTCTGGAAGGTCCTTGCATAAGATG
GAAGGATAAGCATCCACTCTTGATGGCTGCTTTCATCTTGAAAGTAAAAA
back to top