DC900114

Overview
NameDC900114
Unique NameDC900114
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length582
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9543 contig Csv1_Contig9543:716..1296. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900114 VSS Citrus sinensis cDNA clone VS27V28 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900114 ID=DC900114|Name=DC900114|organism=Citrus sinensis|type=EST|length=582bp
GTGGGGTCAACGGTGGCGGTTCCGGTGCTGCTGGGGTCAACGCGGATCCG
GCTACTGACCACTTGTTTGCAAGCTCACCGGTTCCGGCTCATTTCTTGCA
CCCTGGTGCTCGGGGGAATTCTGATCATTTCTTGCCGTATGTGCCTGTGG
CGGCACTCCACCAACAGCAGATGGCAGTGGCGGCTGCCGTGGGGAATCCT
CATTTGCAGGGTCATCAGTATCATAGGCAGATGAGTCATTTTGGGTCGCC
CGCTAACGGGCAATTTGAGCATCATTTATTTGCTAGGCAGGCTCAGCCGC
AGCAAGTCCATAGGATGGGGGCACCCGTGCACAGTACGGTGCCTTCTAGT
TATGTGGAGGATTTGGAGTCTGCAAACGGGGGCAGGAAGGTTCTCACTAT
TGTTTCCAACTGGGGATGATTGAATTGGTGTTAATTTTTATTTAATACTT
TTCTCTGTTTCAGTGTTCAGCTTTTGGGTCATTGTGTAATTGGACTTGGT
GGTTAGTTTTATTGTTTGTCACTGTTGCTGTTAATTATTGCCTAGGGGTA
CTAATCTCGGAAAAAGTCAAAGTTTGAGGGCC
back to top