DC900111

Overview
NameDC900111
Unique NameDC900111
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length196
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900111 VSS Citrus sinensis cDNA clone VS27V25 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900111 ID=DC900111|Name=DC900111|organism=Citrus sinensis|type=EST|length=196bp
GAAATGGGGCTCCCAGAGAGTAGTCACTTTTAGAAAGAGTTCAGTAAGGA
AGAATGTGTTTAACAGCTTGTGTTGTATACTATTTAAAGGTATTGAATCA
TGGTGGCGAAACCAGACGATTCTTCCTGTGGCATTTGCAAATAAAATTTT
GACTGTAAAATGGTTTAGAAATCTAACAACTCTCTTCGGTTTGGTG
back to top