DC900108

Overview
NameDC900108
Unique NameDC900108
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length618
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2825 contig Csv1_Contig2825:103..717. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900108 VSS Citrus sinensis cDNA clone VS27V23 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900108 ID=DC900108|Name=DC900108|organism=Citrus sinensis|type=EST|length=618bp
CTCAATGATATTAGGCATAAACTCATGCAAGATGCTTCCAATGGATATGG
AAAGTGTAGTGCTGCTGACTCGCAAAGGGCCCCTTGTAAACAAACTTCAG
AATTAAGAAAAGCTGCCAGAAATATTAATCTTAACCAGACACCGTCCGAG
GCTTTATTAAAAACATTACTATGATCTCTAAAGGTGTCACTACACTTGGA
ATGGCAGCTTTTATATTTTGGTATTCGAAACCATTTTGTTTTTGAATATT
TTTGTAACAACACCTTTTTTGTATAGCATATACTAATCATTTTTTGGTTA
GGTAGTCGAGTAACTGTTTATTAGAACCTTTGTCAGTTCATTCACCTAAA
GAAGCAGTCAAGCAGATGAGCCATGTGTGGCCTTAGAAGATGGTGTTGTA
GATGCATTTCGTGCTGCTGGATGCCCTCTTATTTTTTTGTGTCCGAGGGT
AGTGTATTTAGGTTGCATATTCTGACCATTTGTTATTAGGCACTATCGGT
CAGAGATGGCTAATTGTAGAAACTTGATATGTATTTAGGGCTATATCTCT
GTTAATTCTTCTCTATTATAACTGTGTTAAAATTCCAGTAAAAAAAACTT
ATTGAATTTTTTGTAGCT
back to top