DC900107

Overview
NameDC900107
Unique NameDC900107
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length317
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig960 contig Csv1_Contig960:291..607. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900107 VSS Citrus sinensis cDNA clone VS27V22 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900107 ID=DC900107|Name=DC900107|organism=Citrus sinensis|type=EST|length=317bp
GGCTACTGGACTTGGATGCTGCATTATGTCTTTGCACCACCATTAAACTT
AAGCTTTTGAATATCAATCTTATTATACCGATCGCCCTTGAAGTGCTTAT
TGACTGCGGCAAGCATCCGCCGCCCGGATTCCAGTGTCCTGCCTAATTGG
TGACGCTTTCCAGCCATGCAATTGATGAATGCGACTTGTTTGTTTTGGAG
ATTTTGTCAAAGATAATGACATGTAAGTGCATAAAGTGGAAGTACTTCAT
GATATCGAAGTTTGTCTTAATATATGTTTTGTTCCTCTTGTGCATATCAA
ACCAATTATCTTTGGAG
back to top