DC900104

Overview
NameDC900104
Unique NameDC900104
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length953
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12882 contig Csv1_Contig12882:364..1317. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900104 VSS Citrus sinensis cDNA clone VS27V19 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900104 ID=DC900104|Name=DC900104|organism=Citrus sinensis|type=EST|length=953bp
GTTTTTTTTCTTTTTTTTATTGAAACTAATCGTCCCATTCATTATTAAGG
ACATACGGAATGGTGTACATGGTAATTCAAACGTTAAAACCACCACAAGA
AAGAACTACAAAGTAGAAGCTGAGAATCATCATCCATCAATTTTCAGTAA
CNTAAAACTAAAAACCACCCGCAACTATACGGCCTCATTGCATATCTTTA
TTTTGGCAGAATTTTTATGGATGTGTCCAAGACTGCCGGAAGTCTAGTGT
GATGCCTCTCCAACCTTCTCTTCTTTCTTGTCCTTCTTCTCTCCGGTGAA
GAACTTGTAACCTCCATAAAAAAGTAAACCCCAGCCAGTTGCAGAGATGA
TCACGAAATGTTCTTCTTTCCATTTAGATGGACTCAAAGGGTCCTCCCAA
AAATTCACCTTCGGAGGTCCATGATGGTCGCCGCCGCCGGCAAGACCGCG
CCGATGGATGAGAGAAGCGGCTTGAGAAGATGATGCTGAAGTGGATTTTG
AGGAGGAGAGCCGAGCCAAGTTTGCGGCTTGGCGAGCCGTTGCTGTCCAC
GCCGACATGGAAGAAGAGAGCTTGAGACTAGAGAGAGTCTCGTGCCGAAT
TCGGCACGAGTTTCGACTGGCGCCATAATGCATACCCCTGACTTTCGGCC
CAATTACTTCCCTCTGTCTCCTGGAGAAATTTGGACTACTGATGGTTGGA
TTCTTGATCATCTCGAATGCGTTCAGATTGAGGGCTTTACGGGAAAGACA
TGTGAAACTGATCTTGTGAAGTTCATGCTGAGAAATTCAAGGTCCATTAA
GGAACTGAACATCAAACAGCTGGTCAGAGCTACTTCATCGGTAACTTCAG
AGGCCTTTAAGGAGATCAATAAGGCGGCGGTGGCTTCTGAAGCTGTCGTG
ATCAATTGGAGTTGAATTTGAAGTAGTGATGATACCTACTGCTATTTGCG
TCA
back to top