DC900096

Overview
NameDC900096
Unique NameDC900096
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1122
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2620 contig Csv1_Contig2620:640..1761. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DC900096 vs. ExPASy Swiss-Prot
Match: IQD14_ARATH (Protein IQ-DOMAIN 14 OS=Arabidopsis thaliana GN=IQD14 PE=1 SV=1)

HSP 1 Score: 244.202 bits (622), Expect = 1.044e-63
Identity = 152/316 (48.10%), Postives = 197/316 (62.34%), Query Frame = 1
Query:   61 QARRQAQHKNDKEAESTLGKWTFGSEAGNHEDWDASLLTKEEMEARMQRKVEAIIKRERAMAYAYSHQLWKSTPKSAQTSLADIRSGGFPWWWNWLERQLPGANTPE--TSAMKNFQLTPPRPNSEIKPSPRVQASTHKQHNFEFSN-MDTPTPKSAKSTILTATRPVRSPSSSKIPQGSPSLSKYSRARVSGAASPFDVPLRDDDSLMSCPPFSVPNYMTPTVSAKAKVRPNSNPKERFPGTPSSESQRRLSFPLTQGIGSFKWXXXXXXXXXXXXXXQR------VLDKNQSLQSIGNLSVDSTVSMPATVGRK 981
            Q+RR    +N  + E    KW   SEAGN ++WD S+LTKEE ++R QRK +AIIKRER+MAYAYS +LWK++PKS Q    D RS  FP WWNW++RQ P A+     +   ++F+LTP    S + PSP  Q+S  KQH+    N  DT TP+S++ST  T +RP+ +             S+YSR R+ G  SPF    +DDDSL SCPPF  P+YM PTVSAKAKVRPNSNPKER  GTP SE +RR+S+P TQ   +F+W                      VL+K+++L+S+GNLS+ ST SM  TVGRK
Sbjct:  381 QSRRIKMLENQAQVEKDEAKWA-ASEAGN-DNWDDSVLTKEERDSRSQRKTDAIIKRERSMAYAYSRKLWKNSPKSTQ----DNRS--FPQWWNWVDRQNPLASPAPSYSQPQRDFRLTP----SRLCPSPLSQSS--KQHHIRLDNHFDTSTPRSSRSTFHTPSRPIHT-----------GTSRYSRGRLRGQDSPF----KDDDSLTSCPPF--PSYMAPTVSAKAKVRPNSNPKERVMGTPVSE-KRRMSYPPTQ--DTFRWNKGSLVMSNSSSHRGPGSPGGVVLEKHKTLKSVGNLSIGSTASMATTVGRK 662          
BLAST of DC900096 vs. ExPASy Swiss-Prot
Match: IQD1_ARATH (Protein IQ-DOMAIN 1 OS=Arabidopsis thaliana GN=IQD1 PE=1 SV=1)

HSP 1 Score: 80.8777 bits (198), Expect = 1.529e-14
Identity = 86/255 (33.73%), Postives = 111/255 (43.53%), Query Frame = 1
Query:   55 ENQAR-RQAQHKNDKEAESTLGKWTFGSEAGNHEDWDASLLTKEEMEARMQRKVEAIIKRERAMAYAYSHQL-WKSTPKSAQTSLADIRSGGFPWWWNWLERQLPGANTPETSAMKNFQLTPPRPNSEIKPSPRVQA---STHKQHNFEFSNMDT-PTPKSAKSTILTATRPVRS-PSSSKIPQGSPSLSKYSRARVSGAASPFDVPLRDDDSLMSCPPFSVPNYMTPTVSAKAKVRPNSNPKERFPGTPSSESQ 798
            ENQAR +Q   K+ KE    LG    G       +W+ S  +KE++EA M  K EA ++RERA+AYA++HQ   KS  K+A     D       W W+WLER + G   P  S+ K  Q T    NS +K S    +    T K  N    N  T P   SA ST     R  R  PSS K            R R    A P    + DD++L S       N +  T SA+ K  P S    R   T S+  +
Sbjct:  176 ENQARHKQLLQKHAKE----LGGLKNGG------NWNYSNQSKEQVEAGMLHKYEATMRRERALAYAFTHQQNLKSFSKTANPMFMD--PSNPTWGWSWLERWMAG--RPWESSEKE-QNTTNNDNSSVKNSTNRNSQGGETAKSSNRNKLNSSTKPNTPSASSTATRNPRKKRPIPSSIKSKSSDDEAKSSERNRRPSIARP---SVSDDETLSSSTARRSSNLIPTTKSARGK--PKSQTSSRVAVTTSTTEE 410          
The following BLAST results are available for this feature:
BLAST of DC900096 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 2
Match NameE-valueIdentityDescription
IQD14_ARATH1.044e-6348.10Protein IQ-DOMAIN 14 OS=Arabidopsis thaliana GN=IQ... [more]
IQD1_ARATH1.529e-1433.73Protein IQ-DOMAIN 1 OS=Arabidopsis thaliana GN=IQD... [more]
back to top
Properties
Property NameValue
Genbank descriptionDC900096 VSS Citrus sinensis cDNA clone VS27V12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900096 ID=DC900096|Name=DC900096|organism=Citrus sinensis|type=EST|length=1122bp
CAGCTCTTGGTACGTGTCCAATCTCAGATTCAGTCTAGGAGGATCCAGAT
GTTAGAGAACCAAGCACGGCGTCAGGCACAACACAAGAATGATAAGGAAG
CAGAAAGTACCTTAGGCAAATGGACATTTGGATCTGAGGCAGGAAATCAT
GAAGACTGGGATGCCAGCTTGCTTACAAAAGAAGAGATGGAGGCAAGAAT
GCAGAGAAAGGTAGAGGCAATCATCAAGAGAGAAAGAGCCATGGCCTATG
CATACTCCCACCAGTTGTGGAAATCCACTCCAAAATCAGCTCAGACATCT
CTTGCGGATATCAGATCAGGAGGATTCCCCTGGTGGTGGAACTGGTTAGA
ACGTCAACTGCCTGGGGCTAATACTCCTGAAACTTCAGCCATGAAGAATT
TCCAACTTACCCCACCAAGGCCAAATTCTGAGATCAAGCCTAGCCCACGC
GTACAAGCTAGCACTCACAAGCAACATAATTTCGAGTTCAGTAACATGGA
TACTCCCACACCAAAATCTGCAAAATCAACCATACTCACAGCAACACGAC
CTGTTCGAAGTCCATCCTCAAGTAAGATCCCACAAGGCAGTCCAAGCCTG
TCAAAATACTCGAGAGCAAGAGTTAGTGGAGCTGCTTCTCCTTTTGACGT
ACCATTGAGGGACGATGACAGCCTCATGAGCTGCCCGCCATTTTCTGTTC
CAAACTATATGACACCGACCGTTTCGGCAAAAGCAAAAGTGAGACCTAAT
AGTAATCCTAAGGAGAGGTTCCCAGGAACTCCAAGCAGTGAATCACAAAG
AAGGCTTTCTTTCCCTTTAACACAAGGCATTGGCTCTTTCAAGTGGAAAA
AAGGTTCATTGCTCTCTACTAGCAAGGATTCCAGCTCTCAAAGGGTTTTA
GACAAGAATCAATCTCTACAATCTATAGGAAATTTGAGTGTGGATTCAAC
TGTTTCCATGCCGGCTACAGTCGGTCGGAAGCCGTTTAACCGATTCGTGT
GATTTTTTTTTTCCATAATTTTTTAACTTTTTTGTTTGATTTCTTGGTGT
TATTTGATTGAGTGTATGATTATATATATTTGGGTTTTTTTTCCCCTTAT
AAAAGATACTGATGTAAGACAA
back to top