DC900093

Overview
NameDC900093
Unique NameDC900093
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length745
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900093_ssr689 microsatellite DC900093_ssr689:689..700. BLAST: Citrus ESTs to Prunus persica proteins V1
DC900093_ssr730 microsatellite DC900093_ssr730:730..745. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig7861 contig Csv1_Contig7861:37..783. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900093 VSS Citrus sinensis cDNA clone VS27V09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900093 ID=DC900093|Name=DC900093|organism=Citrus sinensis|type=EST|length=745bp
AATTCGGCACGAGCTCGTGCCGACTCGTGCCGAATTCGGCACGAGGTTTT
TTTTTTTTTTTTTTGTGATAGAAACTGTGCATTTTATTATGGGATGAAAA
AGAAAGAAAAACGAAAATAAGTTTGTTAACACAAATGAGTTGTTCCTATC
TCGTTTTCAATTTTCTCGCAGAGCACAAAACTATAGCATGTATGTTAAGG
TGACAGAACAATAACAAATATATAAAATGCTGGGAAGCTTTCATCAATTC
AACTTTAGAAGCTGTTTTTGATGCAACTCTCAAACATAGTAGCCAGTTAT
TGTAAATCCCCGCCCTATGATCTCACCAGCACAGTACCATGCAAAGCACT
CTAGCCCAAACAATGCTGCAATACCAGCATCCTCTAACTTGAGTTCCTGC
CTGTTCTTCCATAAGTGCTTCACATAATCAAGCTCTTTCCAGAATGCTTC
ATATCGCCCAGGAATACTGCTAAGACGAGTGTAAAACAATTGCTTGGATA
AAAGATTACATTTCTCAACAGTTGGCGGCTCCTGAATGTATTGCTTGTTC
TGTTCTAACAACTGTCTGTAGTAAGAAGTTCCATGCTTGGCCACAAACTT
TGAGGCCTCGGCAGCCTTGGATTGCAACTGCACCAGCTTGGATGCCATTG
CTTCCCCAACTTCGTTTGCGTTTTGAAAGAGAGAGAACGAGAGAGAGAGA
GGNCNCTCGTGCCGAATTCGGCNCGAGGGGAGAGAGAGAGAGAGA
back to top