DC900084

Overview
NameDC900084
Unique NameDC900084
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length517
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionDC900084 VSS Citrus sinensis cDNA clone VS27Q92 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900084 ID=DC900084|Name=DC900084|organism=Citrus sinensis|type=EST|length=517bp
TTTTAAATGGCTAGACTTGTGTTGGTTTCACTATTCATTGTGGCTGAGAT
TTTAATGGTACAAGCCGTGGCTGATAAATCTGAAGTGAACCCAGTTGGGT
TTAATAAGCCTGAGCCAGCTAGGGTGGCGGATCAGCCTGCTTCAAGCGTC
TCTGAGTCATCTTATTATCATAATGATCCTGAAGCAGCTGAGGCTCCGGA
GATCAGACGGCTGGGAAAGCATCATCAGCATCATTCTGATAAGTCAGTGG
CTGGCGGTGGTGTCATCATTGGTGGCCTTGTTACTGCTATTTTTGCTGCT
GTGTTTTGCTACATCAGGGTTACAAGGAAAAGGAATGGCGCTGATGCTAA
CTGACCAATTTTTAGAATTATTCACATTTTTACCTCCCCTTTTTCTCATT
TGCTAAGAGTGGGAGAGCAAATGAGTGATTTTGAAACAAATCTATATACA
TGATGGAATCTGAGGATATACACTGTATTGTTTGATATCTTGTGTGAATA
TTAGATTGAAATTTCTT
back to top